Provided by: libhts3t64_1.19+ds-1.1build3_amd64 

NAME
faidx - an index enabling random access to FASTA and FASTQ files
SYNOPSIS
file.fa.fai, file.fasta.fai, file.fq.fai, file.fastq.fai
DESCRIPTION
Using an fai index file in conjunction with a FASTA/FASTQ file containing reference sequences enables efficient access to arbitrary regions within those reference sequences. The index file typically has the same filename as the corresponding FASTA/FASTQ file, with .fai appended. An fai index file is a text file consisting of lines each with five TAB-delimited columns for a FASTA file and six for FASTQ: NAME Name of this reference sequence LENGTH Total length of this reference sequence, in bases OFFSET Offset in the FASTA/FASTQ file of this sequence's first base LINEBASES The number of bases on each line LINEWIDTH The number of bytes in each line, including the newline QUALOFFSET Offset of sequence's first quality within the FASTQ file The NAME and LENGTH columns contain the same data as would appear in the SN and LN fields of a SAM @SQ header for the same reference sequence. The OFFSET column contains the offset within the FASTA/FASTQ file, in bytes starting from zero, of the first base of this reference sequence, i.e., of the character following the newline at the end of the header line (the ">" line in FASTA, "@" in FASTQ). Typically the lines of a fai index file appear in the order in which the reference sequences appear in the FASTA/FASTQ file, so .fai files are typically sorted according to this column. The LINEBASES column contains the number of bases in each of the sequence lines that form the body of this reference sequence, apart from the final line which may be shorter. The LINEWIDTH column contains the number of bytes in each of the sequence lines (except perhaps the final line), thus differing from LINEBASES in that it also counts the bytes forming the line terminator. The QUALOFFSET works the same way as OFFSET but for the first quality score of this reference sequence. This would be the first character following the newline at the end of the "+" line. For FASTQ files only. FASTA Files In order to be indexed with samtools faidx, a FASTA file must be a text file of the form >name [description...] ATGCATGCATGCATGCATGCATGCATGCAT GCATGCATGCATGCATGCATGCATGCATGC ATGCAT >name [description...] ATGCATGCATGCAT GCATGCATGCATGC [...] In particular, each reference sequence must be "well-formatted", i.e., all of its sequence lines must be the same length, apart from the final sequence line which may be shorter. (While this sequence line length must be the same within each sequence, it may vary between different reference sequences in the same FASTA file.) This also means that although the FASTA file may have Unix- or Windows-style or other line termination, the newline characters present must be consistent, at least within each reference sequence. The samtools implementation uses the first word of the ">" header line text (i.e., up to the first whitespace character, having skipped any initial whitespace after the ">") as the NAME column. FASTQ Files FASTQ files for indexing work in the same way as the FASTA files. @name [description...] ATGCATGCATGCATGCATGCATGCATGCAT GCATGCATGCATGCATGCATGCATGCATGC ATGCAT + FFFA@@FFFFFFFFFFHHB:::@BFFFFGG HIHIIIIIIIIIIIIIIIIIIIIIIIFFFF 8011<< @name [description...] ATGCATGCATGCAT GCATGCATGCATGC + IIA94445EEII== =>IIIIIIIIICCC [...] Quality lines must be wrapped at the same length as the corresponding sequence lines.
EXAMPLE
For example, given this FASTA file >one ATGCATGCATGCATGCATGCATGCATGCAT GCATGCATGCATGCATGCATGCATGCATGC ATGCAT >two another chromosome ATGCATGCATGCAT GCATGCATGCATGC formatted with Unix-style (LF) line termination, the corresponding fai index would be one 66 5 30 31 two 28 98 14 15 If the FASTA file were formatted with Windows-style (CR-LF) line termination, the fai index would be one 66 6 30 32 two 28 103 14 16 An example FASTQ file @fastq1 ATGCATGCATGCATGCATGCATGCATGCAT GCATGCATGCATGCATGCATGCATGCATGC ATGCAT + FFFA@@FFFFFFFFFFHHB:::@BFFFFGG HIHIIIIIIIIIIIIIIIIIIIIIIIFFFF 8011<< @fastq2 ATGCATGCATGCAT GCATGCATGCATGC + IIA94445EEII== =>IIIIIIIIICCC Formatted with Unix-style line termination would give this fai index fastq1 66 8 30 31 79 fastq2 28 156 14 15 188
SEE ALSO
samtools(1) https://en.wikipedia.org/wiki/FASTA_format https://en.wikipedia.org/wiki/FASTQ_format Further description of the FASTA and FASTQ formats htslib June 2018 faidx(5)