Provided by: vienna-rna_2.6.4+dfsg-1build2_amd64 bug

NAME

       RNAup - manual page for RNAup 2.6.4

SYNOPSIS

       RNAup [OPTION]...

DESCRIPTION

       RNAup 2.6.4

       Calculate the thermodynamics of RNA-RNA interactions

       RNAup  calculates the thermodynamics of RNA-RNA interactions, by decomposing the binding into two stages.
       (1) First the probability that a potential binding sites remains unpaired (equivalent to the free  energy
       needed to open the site) is computed. (2) Then this accessibility is combined with the interaction energy
       to  obtain  the total binding energy. All calculations are done by computing partition functions over all
       possible conformations.

       RNAup provides two different modes: By default RNAup computes  accessibilities,  in  terms  of  the  free
       energies  needed  to  open a region (default length 4). It prints the region of highest accessibility and
       its opening energy to stdout, opening energies for all other regions are written to a file.

       In interaction mode the interaction between two RNAs is calculated. It is invoked if the  input  consists
       of two sequences concatenated with an '&', or if the options -X[pf] or -b are given. Unless the -b option
       is  specified  RNAup assumes that the longer RNA is a structured target sequence while the shorter one is
       an unstructured small RNA.
       Additionally, for every position along the target sequence we write the best free energy of  binding  for
       an  interaction  that  includes  this  position to the the output file.  Output to stdout consists of the
       location and free energy, dG, for the optimal region of interaction. The binding energy dG is also  split
       into its components the interaction energy dGint and the opening energy dGu_l (and possibly dGu_s for the
       shorter sequence).
       In  addition  we  print  the optimal interaction structure as computed by RNAduplex for this region. Note
       that it can happen that the RNAduplex computed optimal interaction does not  coincide  with  the  optimal
       RNAup  region. If the two predictions don't match the structure string is replaced by a run of "."  and a
       message is written to stderr.

       Each sequence should be in 5' to 3' direction. If the sequence is preceded by a line of the form
       > name

       the output file "name_ux_up.out" is produced, where the "x" in "ux" is the value set by  the  -u  option.
       Otherwise  the  file  name  defaults to RNA_ux_up.out. The output is concatenated if a file with the same
       name exists.

       RNA sequences are read from stdin as strings of characters. White space and  newline  within  a  sequence
       cause  an  error!  Newline is used to separate sequences. The program will continue to read new sequences
       until a line consisting of the single character @ or an end of file condition is encountered.

       -h, --help
              Print help and exit

       --detailed-help
              Print help, including all details and hidden options, and exit

       --full-help
              Print help, including hidden options, and exit

       -V, --version
              Print version and exit

   I/O Options:
              Command line options for input and output (pre-)processing

       -o, --no_output_file
              Do not produce an output file.

              (default=off)

       --no_header
              Do not produce a header with the command line parameters used in the outputfile.

              (default=off)

       --noconv
              Do not automatically substitute nucleotide "T" with "U".

              (default=off)

   Algorithms:
              Select additional algorithms which should be included in the calculations.

       -u, --ulength=length
              Specify the length of the unstructured region in the output.

              (default=`4')

              The probability of being unpaired is plotted on the right border of the unpaired region.  You  can
              specify up to 20 different length values: use "-" to specify a range of continuous values (e.g. -u
              4-8) or specify a list of comma separated values (e.g. -u 4,8,15).

       -c, --contributions=SHIME
              Specify the contributions listed in the output.  (default=`S')

              By default only the full probability of being unpaired is plotted. The -c option allows one to get
              the  different  contributions  (c)  to  the probability of being unpaired: The full probability of
              being unpaired ("S" is the sum of the probability of being unpaired in the  exterior  loop  ("E"),
              within  a  hairpin  loop  ("H"),  within  an interior loop ("I") and within a multiloop ("M"). Any
              combination of these letters may be given.

   Calculations of RNA-RNA interactions:
       -w, --window=INT
              Set the maximal length of the region of interaction.

              (default=`25')

       -b, --include_both
              Include the probability of unpaired regions in both (b) RNAs.

              (default=off)

              By default only the probability of being unpaired in the longer RNA (target) is used.

       -5, --extend5=INT
              Extend the region of interaction in the target to some residues on the 5' side.

              The underlying assumption is that it is favorable for an interaction if not only the direct region
              of contact is unpaired but also a few residues 5'

       -3, --extend3=INT
              Extend the region of interaction in the target to some residues on the 3' side.

              The underlying assumption is that it is favorable for an interaction if not only the direct region
              of contact is unpaired but also a few residues 3'

       --interaction_pairwise
              Activate pairwise interaction mode.  (default=off)

              The first sequence interacts with the  2nd,  the  third  with  the  4th  etc.  If  activated,  two
              interacting sequences may be given in a single line separated by "&" or each sequence may be given
              on an extra line.

       --interaction_first
              Activate interaction mode using first sequence only.

              (default=off)

              The  interaction  of each sequence with the first one is calculated (e.g.  interaction of one mRNA
              with many small RNAs). Each sequence has to be given on an extra line

       -S, --pfScale=DOUBLE
              In the calculation of the pf use scale*mfe as an estimate for the ensemble free  energy  (used  to
              avoid overflows).

              (default=`1.07')

              The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences.

   Structure Constraints:
              Command line options to interact with the structure constraints feature of this program

       -C, --constraint
              Apply structural constraint(s) during prediction.

              (default=off)

              The  program first reads the sequence(s), then a dot-bracket like string containing constraints on
              the structure. The following symbols are recognized:

              '.' ... no constraint for this base

              'x' ... the base is unpaired

              '<' ... the base pairs downstream, i.e. i is paired with j > i

              '>' ... the base pairs upstream, i.e. i is paired with j < i

              '()' ... base i pairs with base j

              '|' ... the corresponding base has to be paired intermolecularily (only for

              interaction mode)

   Energy Parameters:
              Energy parameter sets can be adapted or loaded from user-provided input files

       -T, --temp=DOUBLE
              Rescale energy parameters to a temperature of temp C. Default is 37C.

              (default=`37.0')

       -P, --paramFile=paramfile
              Read energy parameters from paramfile, instead of using the default parameter set.

              Different sets of energy parameters for RNA and DNA should accompany your distribution.   See  the
              RNAlib  documentation  for details on the file format. The placeholder file name 'DNA' can be used
              to load DNA parameters without the need to actually specify any input file.

       -4, --noTetra
              Do not include special tabulated stabilizing energies for tri-, tetra- and hexaloop hairpins.

              (default=off)

              Mostly for testing.

       --salt=DOUBLE
              Set salt concentration in molar (M). Default is 1.021M.

       --saltInit=DOUBLE
              Provide salt correction for duplex initialization (in kcal/mol).

   Model Details:
              Tweak the energy model and pairing rules additionally using the following parameters

       -d, --dangles=INT
              Specify "dangling end" model for bases adjacent to helices in free ends and multi-loops.

              (default=`2')

              With -d2 dangling energies will be added for the bases adjacent to a helix on both  sides  in  any
              case.

              The option -d0 ignores dangling ends altogether (mostly for debugging).

       --noLP Produce structures without lonely pairs (helices of length 1).

              (default=off)

              For partition function folding this only disallows pairs that can only occur isolated. Other pairs
              may still occasionally occur as helices of length 1.

       --noGU Do not allow GU pairs.

              (default=off)

       --noClosingGU
              Do not allow GU pairs at the end of helices.

              (default=off)

       --nsp=STRING
              Allow other pairs in addition to the usual AU,GC,and GU pairs.

              Its  argument is a comma separated list of additionally allowed pairs. If the first character is a
              "-" then AB will imply that AB and BA are allowed pairs, e.g. --nsp="-GA"  will allow  GA  and  AG
              pairs. Nonstandard pairs are given 0 stacking energy.

       -e, --energyModel=INT
              Set energy model.

              Rarely  used  option  to fold sequences from the artificial ABCD... alphabet, where A pairs B, C-D
              etc.  Use the energy parameters for GC (-e 1) or AU (-e 2) pairs.

       --helical-rise=FLOAT
              Set the helical rise of the helix in units of Angstrom.

              (default=`2.8')

              Use with caution! This value will be re-set automatically to 3.4 in case DNA parameters are loaded
              via -P DNA and no further value is provided.

       --backbone-length=FLOAT
              Set the average backbone length for looped regions in units of Angstrom.

              (default=`6.0')

              Use with caution! This value will be re-set automatically to  6.76  in  case  DNA  parameters  are
              loaded via -P DNA and no further value is provided.

REFERENCES

       If you use this program in your work you might want to cite:

       R.  Lorenz,  S.H. Bernhart, C. Hoener zu Siederdissen, H. Tafer, C. Flamm, P.F. Stadler and I.L. Hofacker
       (2011), "ViennaRNA Package 2.0", Algorithms for Molecular Biology: 6:26

       I.L. Hofacker, W. Fontana, P.F. Stadler, S. Bonhoeffer, M. Tacker, P. Schuster (1994), "Fast Folding  and
       Comparison of RNA Secondary Structures", Monatshefte f. Chemie: 125, pp 167-188

       R.  Lorenz,  I.L. Hofacker, P.F. Stadler (2016), "RNA folding with hard and soft constraints", Algorithms
       for Molecular Biology 11:1 pp 1-13

       U. Mueckstein, H. Tafer, J. Hackermueller,  S.H.  Bernhart,  P.F.  Stadler,  and  I.L.  Hofacker  (2006),
       "Thermodynamics of RNA-RNA Binding", Bioinformatics: 22(10), pp 1177-1182

       The energy parameters are taken from:

       D.H.  Mathews,  M.D.  Disney,  D.  Matthew,  J.L. Childs, S.J. Schroeder, J. Susan, M. Zuker, D.H. Turner
       (2004), "Incorporating chemical  modification  constraints  into  a  dynamic  programming  algorithm  for
       prediction of RNA secondary structure", Proc. Natl. Acad. Sci. USA: 101, pp 7287-7292

       D.H  Turner, D.H. Mathews (2009), "NNDB: The nearest neighbor parameter database for predicting stability
       of nucleic acid secondary structure", Nucleic Acids Research: 38, pp 280-282

EXAMPLES

       Output to stdout:

       In Interaction mode RNAup prints the most favorable interaction  energy  between  the  two  sequences  to
       stdout. The most favorable interaction energy (dG) depends on the position in the longer sequence (region
       [i,j])  and  the position in the shorter sequence (region[k,l]): dG[i,j;k,l].  dG[i,j;k,l] is the largest
       contribution to dG[i,j] = sum_kl dG[i,j;k,l] which is given in the output file: therefore dG[i,j;k,l]  <=
       dG[i,j].

         '....,....1....,....2....,....3....,....4....,....5....,....6....,....7....,....8'
         > franz
         GGAGUAGGUUAUCCUCUGUU
         > sissi
         AGGACAACCU
         dG = dGint + dGu_l
         (((((.((((&)))).)))))   6,15  :   1,10  (-6.66 = -9.89 + 3.23)
         AGGUUAUCCU&AGGACAACCU
         RNAup output in file: franz_sissi_w25_u3_4_up.out

       where the result line contains following information

         RNAduplex results       [i,j]     [k,l]    dG = dGint + dGu_l
         (((((.((((&)))).)))))   6,15   :  1,10     (-6.66=-9.89+3.23)

       Output to file:

       Output  to file contains a header including date, the command line of the call to RNAup, length and names
       of the input sequence(s) followed by  the  sequence(s).  The  first  sequence  is  the  target  sequence.
       Printing of the header can be turned off using the -nh option.

       The line directly after the header gives the column names for the output:

         position     dGu_l for -u 3      dGu_l for -u 4       dG
       #     pos      u3S       u3H       u4S       u4H        dG

       where  all  information refers to the target sequence. The dGu_l column contains information about the -u
       value (u=3 or u=4) and the contribution to the free energy to open all structures  "S"  or  only  hairpin
       loops  "H",  see  option  -c.   NA means that no results is possible (e.g. column u3S row 2: no region of
       length 3 ending at position 2 exists).

       #  Thu Apr 10 09:15:11 2008
       #  RNAup -u 3,4 -c SH -b
       #  20 franz
       #  GGAGUAGGUUAUCCUCUGUU
       #  10 sissi
       #  AGGACAACCU
       #     pos      u3S       u3H       u4S       u4H        dG
              1        NA        NA        NA        NA    -1.540
              2        NA        NA        NA        NA    -1.540
              3     1.371        NA        NA        NA    -1.217
              4     1.754     5.777     1.761        NA    -1.393
              5     1.664     3.140     1.811     5.800    -1.393

       If the -b option is selected position and dGu_s values for the shorter sequence  are  written  after  the
       information for the target sequence.

AUTHOR

       Ivo L Hofacker, Peter F Stadler, Ulrike Mueckstein, Ronny Lorenz

REPORTING BUGS

       If in doubt our program is right, nature is at fault.  Comments should be sent to rna@tbi.univie.ac.at.

RNAup 2.6.4                                       January 2025                                          RNAUP(1)