Provided by: parallel_20210822+ds-2_all bug

NAME

       parallel - build and execute shell command lines from standard input in parallel

SYNOPSIS

       parallel [options] [command [arguments]] < list_of_arguments

       parallel [options] [command [arguments]] ( ::: arguments | :::+ arguments | :::: argfile(s) | ::::+
       argfile(s) ) ...

       parallel --semaphore [options] command

       #!/usr/bin/parallel --shebang [options] [command [arguments]]

       #!/usr/bin/parallel --shebang-wrap [options] [command [arguments]]

DESCRIPTION

       STOP!

       Read the Reader's guide below if you are new to GNU parallel.

       GNU parallel is a shell tool for executing jobs in parallel using one or more computers. A job can be a
       single command or a small script that has to be run for each of the lines in the input. The typical input
       is a list of files, a list of hosts, a list of users, a list of URLs, or a list of tables. A job can also
       be a command that reads from a pipe. GNU parallel can then split the input into blocks and pipe a block
       into each command in parallel.

       If you use xargs and tee today you will find GNU parallel very easy to use as GNU parallel is written to
       have the same options as xargs. If you write loops in shell, you will find GNU parallel may be able to
       replace most of the loops and make them run faster by running several jobs in parallel.

       GNU parallel makes sure output from the commands is the same output as you would get had you run the
       commands sequentially. This makes it possible to use output from GNU parallel as input for other
       programs.

       For each line of input GNU parallel will execute command with the line as arguments. If no command is
       given, the line of input is executed. Several lines will be run in parallel. GNU parallel can often be
       used as a substitute for xargs or cat | bash.

   Reader's guide
       GNU parallel includes the 4 types of documentation: Tutorial, how-to, reference and explanation.

       Tutorial

       If you prefer reading a book buy GNU Parallel 2018 at
       https://www.lulu.com/shop/ole-tange/gnu-parallel-2018/paperback/product-23558902.html or download it at:
       https://doi.org/10.5281/zenodo.1146014 Read at least chapter 1+2. It should take you less than 20
       minutes.

       Otherwise start by watching the intro videos for a quick introduction:
       https://youtube.com/playlist?list=PL284C9FF2488BC6D1

       If you want to dive deeper: spend a couple of hours walking through the tutorial (man parallel_tutorial).
       Your command line will love you for it.

       How-to

       You can find a lot of EXAMPLEs of use after the list of OPTIONS in man parallel (Use LESS=+/EXAMPLE: man
       parallel). That will give you an idea of what GNU parallel is capable of, and you may find a solution you
       can simply adapt to your situation.

       Reference

       If you need a one page printable cheat sheet you can find it on:
       https://www.gnu.org/software/parallel/parallel_cheat.pdf

       The man page is the reference for all options.

       Design discussion

       If you want to know the design decisions behind GNU parallel, try: man parallel_design. This is also a
       good intro if you intend to change GNU parallel.

OPTIONS

       command
           Command  to  execute.  If command or the following arguments contain replacement strings (such as {})
           every instance will be substituted with the input.

           If command is given, GNU parallel solve the same tasks as xargs. If command is not given GNU parallel
           will behave similar to cat | sh.

           The command must be an executable, a script, a composed command, an alias, or a function.

           Bash functions: export -f the function first or use env_parallel.

           Bash, Csh, or Tcsh aliases: Use env_parallel.

           Zsh, Fish, Ksh, and Pdksh functions and aliases: Use env_parallel.

       {}  Input line. This replacement string will be replaced by a full line read from the input  source.  The
           input source is normally stdin (standard input), but can also be given with -a, :::, or ::::.

           The replacement string {} can be changed with -I.

           If the command line contains no replacement strings then {} will be appended to the command line.

           Replacement  strings  are  normally  quoted,  so  special characters are not parsed by the shell. The
           exception is if the command starts with a replacement string; then the string is not quoted.

       {.} Input line without extension. This replacement  string  will  be  replaced  by  the  input  with  the
           extension  removed.  If  the  input line contains . after the last /, the last . until the end of the
           string will be removed and {.} will be  replaced  with  the  remaining.  E.g.  foo.jpg  becomes  foo,
           subdir/foo.jpg   becomes   subdir/foo,   sub.dir/foo.jpg  becomes  sub.dir/foo,  sub.dir/bar  remains
           sub.dir/bar. If the input line does not contain . it will remain unchanged.

           The replacement string {.} can be changed with --er.

           To understand replacement strings see {}.

       {/} Basename of input line. This replacement string will be replaced by the input with the directory part
           removed.

           The replacement string {/} can be changed with --basenamereplace.

           To understand replacement strings see {}.

       {//}
           Dirname of input line. This replacement string will be replaced by the dir of  the  input  line.  See
           dirname(1).

           The replacement string {//} can be changed with --dirnamereplace.

           To understand replacement strings see {}.

       {/.}
           Basename  of input line without extension. This replacement string will be replaced by the input with
           the directory and extension part removed. It is a combination of {/} and {.}.

           The replacement string {/.} can be changed with --basenameextensionreplace.

           To understand replacement strings see {}.

       {#} Sequence number of the job to run. This replacement string will be replaced by the sequence number of
           the job being run. It contains the same number as $PARALLEL_SEQ.

           The replacement string {#} can be changed with --seqreplace.

           To understand replacement strings see {}.

       {%} Job slot number. This replacement string will be replaced by the job's  slot  number  between  1  and
           number  of jobs to run in parallel. There will never be 2 jobs running at the same time with the same
           job slot number.

           The replacement string {%} can be changed with --slotreplace.

           If the job needs to be  retried  (e.g  using  --retries  or  --retry-failed)  the  job  slot  is  not
           automatically updated. You should then instead use $PARALLEL_JOBSLOT:

             $ do_test() {
                 id="$3 {%}=$1 PARALLEL_JOBSLOT=$2"
                 echo run "$id";
                 sleep 1
                 # fail if {%} is odd
                 return `echo $1%2 | bc`
               }
             $ export -f do_test
             $ parallel -j3 --jl mylog do_test {%} \$PARALLEL_JOBSLOT {} ::: A B C D
             run A {%}=1 PARALLEL_JOBSLOT=1
             run B {%}=2 PARALLEL_JOBSLOT=2
             run C {%}=3 PARALLEL_JOBSLOT=3
             run D {%}=1 PARALLEL_JOBSLOT=1
             $ parallel --retry-failed -j3 --jl mylog do_test {%} \$PARALLEL_JOBSLOT {} ::: A B C D
             run A {%}=1 PARALLEL_JOBSLOT=1
             run C {%}=3 PARALLEL_JOBSLOT=2
             run D {%}=1 PARALLEL_JOBSLOT=3

           Notice how {%} and $PARALLEL_JOBSLOT differ in the retry run of C and D.

           To understand replacement strings see {}.

       {n} Argument  from  input  source  n  or  the  n'th  argument. This positional replacement string will be
           replaced by the input from input source n (when used with -a or ::::) or with the n'th argument (when
           used with -N). If n is negative it refers to the n'th last argument.

           To understand replacement strings see {}.

       {n.}
           Argument from input source n or the n'th argument without extension. It is a combination of  {n}  and
           {.}.

           This  positional replacement string will be replaced by the input from input source n (when used with
           -a or ::::) or with the n'th argument (when used with -N). The input will have the extension removed.

           To understand positional replacement strings see {n}.

       {n/}
           Basename of argument from input source n or the n'th argument.  It is a combination of {n} and {/}.

           This positional replacement string will be replaced by the input from input source n (when used  with
           -a or ::::) or with the n'th argument (when used with -N). The input will have the directory (if any)
           removed.

           To understand positional replacement strings see {n}.

       {n//}
           Dirname of argument from input source n or the n'th argument.  It is a combination of {n} and {//}.

           This positional replacement string will be replaced by the dir of the input from input source n (when
           used with -a or ::::) or with the n'th argument (when used with -N). See dirname(1).

           To understand positional replacement strings see {n}.

       {n/.}
           Basename of argument from input source n or the n'th argument without extension.  It is a combination
           of {n}, {/}, and {.}.

           This  positional replacement string will be replaced by the input from input source n (when used with
           -a or ::::) or with the n'th argument (when used with -N). The input will have the directory (if any)
           and extension removed.

           To understand positional replacement strings see {n}.

       {=perl expression=}
           Replace with calculated perl expression. $_ will contain  the  same  as  {}.  After  evaluating  perl
           expression $_ will be used as the value. It is recommended to only change $_ but you have full access
           to all of GNU parallel's internal functions and data structures.

           The  expression  must give the same result if evaluated twice - otherwise the behaviour is undefined.
           E.g. this will not work as expected:

               parallel echo '{= $_= ++$wrong_counter =}' ::: a b c

           A few convenience functions and data structures have been made:

            Q(string)     shell quote a string

            pQ(string)    perl quote a string

            uq() (or uq)  do not quote current replacement string

            hash(val)     compute B::hash(val)

            total_jobs()  number of jobs in total

            slot()        slot number of job

            seq()         sequence number of job

            @arg          the arguments

            skip()        skip this job (see also --filter)

            yyyy_mm_dd_hh_mm_ss()
            yyyy_mm_dd_hh_mm()
            yyyy_mm_dd()
            yyyymmddhhmmss()
            yyyymmddhhmm()
            yyyymmdd()    time functions

           Example:

             seq 10 | parallel echo {} + 1 is {= '$_++' =}
             parallel csh -c {= '$_="mkdir ".Q($_)' =} ::: '12" dir'
             seq 50 | parallel echo job {#} of {= '$_=total_jobs()' =}

           See also: --rpl --parens

       {=n perl expression=}
           Positional equivalent to {=perl expression=}. To understand positional replacement strings see {n}.

           See also: {=perl expression=} {n}.

       ::: arguments
           Use arguments from the command line as input source instead of stdin (standard input).  Unlike  other
           options for GNU parallel ::: is placed after the command and before the arguments.

           The following are equivalent:

             (echo file1; echo file2) | parallel gzip
             parallel gzip ::: file1 file2
             parallel gzip {} ::: file1 file2
             parallel --arg-sep ,, gzip {} ,, file1 file2
             parallel --arg-sep ,, gzip ,, file1 file2
             parallel ::: "gzip file1" "gzip file2"

           To  avoid  treating ::: as special use --arg-sep to set the argument separator to something else. See
           also --arg-sep.

           If multiple ::: are given, each group will be treated as an input source,  and  all  combinations  of
           input  sources  will be generated. E.g. ::: 1 2 ::: a b c will result in the combinations (1,a) (1,b)
           (1,c) (2,a) (2,b) (2,c). This is useful for replacing nested for-loops.

           ::: and :::: can be mixed. So these are equivalent:

             parallel echo {1} {2} {3} ::: 6 7 ::: 4 5 ::: 1 2 3
             parallel echo {1} {2} {3} :::: <(seq 6 7) <(seq 4 5) \
               :::: <(seq 1 3)
             parallel -a <(seq 6 7) echo {1} {2} {3} :::: <(seq 4 5) \
               :::: <(seq 1 3)
             parallel -a <(seq 6 7) -a <(seq 4 5) echo {1} {2} {3} \
               ::: 1 2 3
             seq 6 7 | parallel -a - -a <(seq 4 5) echo {1} {2} {3} \
               ::: 1 2 3
             seq 4 5 | parallel echo {1} {2} {3} :::: <(seq 6 7) - \
               ::: 1 2 3

       :::+ arguments
           Like ::: but linked like --link to the previous input source.

           Contrary to --link, values do not wrap: The shortest input source determines the length.

           Example:

             parallel echo ::: a b c :::+ 1 2 3 ::: X Y :::+ 11 22

       :::: argfiles
           Another way to write -a argfile1 -a argfile2 ...

           ::: and :::: can be mixed.

           See -a, ::: and --link.

       ::::+ argfiles
           Like :::: but linked like --link to the previous input source.

           Contrary to --link, values do not wrap: The shortest input source determines the length.

       --null
       -0  Use NUL as delimiter.  Normally input lines will end in \n (newline). If they end in \0  (NUL),  then
           use this option. It is useful for processing arguments that may contain \n (newline).

       --arg-file input-file
       -a input-file
           Use  input-file as input source. If you use this option, stdin (standard input) is given to the first
           process run.  Otherwise, stdin (standard input) is redirected from /dev/null.

           If multiple -a are given, each input-file will be treated as an input source, and all combinations of
           input sources will be generated. E.g. The file foo contains 1 2, the file bar contains a b c.  -a foo
           -a bar will result in the combinations (1,a) (1,b) (1,c)  (2,a)  (2,b)  (2,c).  This  is  useful  for
           replacing nested for-loops.

           See also: --link and {n}.

       --arg-file-sep sep-str
           Use sep-str instead of :::: as separator string between command and argument files. Useful if :::: is
           used for something else by the command.

           See also: ::::.

       --arg-sep sep-str
           Use  sep-str  instead  of  :::  as  separator string. Useful if ::: is used for something else by the
           command.

           Also useful if you command uses ::: but you still want to read arguments from stdin (standard input):
           Simply change --arg-sep to a string that is not in the command line.

           See also: :::.

       --bar
           Show progress as a progress bar. In the bar is shown: % of jobs completed,  estimated  seconds  left,
           and number of jobs started.

           It is compatible with zenity:

             seq 1000 | parallel -j30 --bar '(echo {};sleep 0.1)' \
               2> >(perl -pe 'BEGIN{$/="\r";$|=1};s/\r/\n/g' |
                    zenity --progress --auto-kill) | wc

       --basefile file
       --bf file
           file will be transferred to each sshlogin before a job is started. It will be removed if --cleanup is
           active.  The  file may be a script to run or some common base data needed for the job.  Multiple --bf
           can be specified to  transfer  more  basefiles.  The  file  will  be  transferred  the  same  way  as
           --transferfile.

       --basenamereplace replace-str
       --bnr replace-str
           Use the replacement string replace-str instead of {/} for basename of input line.

       --basenameextensionreplace replace-str
       --bner replace-str
           Use the replacement string replace-str instead of {/.} for basename of input line without extension.

       --bin binexpr
           Use binexpr as binning key and bin input to the jobs.

           binexpr is [column number|column name] [perlexpression] e.g. 3, Address, 3 $_%=100, Address s/\D//g.

           Each  input line is split using --colsep. The value of the column is put into $_, the perl expression
           is executed, the resulting value is is the job slot that will be given the  line.  If  the  value  is
           bigger than the number of jobslots the value will be modulo number of jobslots.

           This  is  similar to --shard but the hashing algorithm is a simple modulo, which makes it predictible
           which jobslot will receive which value.

           The performance is in the order of 100K rows per second. Faster if the bincol is small (<10),  slower
           if it is big (>100).

           --bin requires --pipe and a fixed numeric value for --jobs.

           See also: --shard, --group-by, --roundrobin.

       --bg
           Run  command  in  background  thus  GNU  parallel  will not wait for completion of the command before
           exiting. This is the default if --semaphore is set.

           See also: --fg, man sem.

           Implies --semaphore.

       --block size
       --block-size size
           Size of block in bytes to read at a time. The size can be postfixed with K, M, G, T, P, k, m,  g,  t,
           or p (see UNIT PREFIX).

           GNU parallel tries to meet the block size but can be off by the length of one record. For performance
           reasons  size  should  be  bigger  than  a  two records. GNU parallel will warn you and automatically
           increase the size if you choose a size that is too small.

           If you use -N, --block-size should be bigger than N+1 records.

           size defaults to 1M.

           When using --pipepart a negative block size is not interpreted as a blocksize but as  the  number  of
           blocks each jobslot should have. So this will run 10*5 = 50 jobs in total:

             parallel --pipepart -a myfile --block -10 -j5 wc

           This  is an efficient alternative to --roundrobin because data is never read by GNU parallel, but you
           can still have very few jobslots process a large amount of data.

           See --pipe and --pipepart for use of this.

       --blocktimeout duration
       --bt duration
           Time out for reading block when using --pipe. If it takes longer than duration to read a full  block,
           use the partial block read so far.

           duration  must be in whole seconds, but can be expressed as floats postfixed with s, m, h, or d which
           would multiply the float by 1, 60, 3600, or 86400. Thus these are equivalent:  --blocktimeout  100000
           and --blocktimeout 1d3.5h16.6m4s.

       --cat
           Create  a  temporary  file  with content. Normally --pipe/--pipepart will give data to the program on
           stdin (standard input). With --cat GNU parallel will create a temporary file with the name in {},  so
           you can do: parallel --pipe --cat wc {}.

           Implies --pipe unless --pipepart is used.

           See also: --fifo.

       --cleanup
           Remove  transferred  files.  --cleanup will remove the transferred files on the remote computer after
           processing is done.

             find log -name '*gz' | parallel \
               --sshlogin server.example.com --transferfile {} \
               --return {.}.bz2 --cleanup "zcat {} | bzip -9 >{.}.bz2"

           With --transferfile {} the file transferred to the remote computer will  be  removed  on  the  remote
           computer. Directories on the remote computer containing the file will be removed if they are empty.

           With  --return  the file transferred from the remote computer will be removed on the remote computer.
           Directories on the remote computer containing the file will be removed if they are empty.

           --cleanup is ignored when not used with --transferfile or --return.

       --colsep regexp
       -C regexp
           Column separator. The input will be treated as a table with regexp separating the columns.  The  n'th
           column can be accessed using {n} or {n.}. E.g. {3} is the 3rd column.

           If there are more input sources, each input source will be separated, but the columns from each input
           source will be linked (see --link).

             parallel --colsep '-' echo {4} {3} {2} {1} \
               ::: A-B C-D ::: e-f g-h

           --colsep implies --trim rl, which can be overridden with --trim n.

           regexp is a Perl Regular Expression: https://perldoc.perl.org/perlre.html

       --compress
           Compress  temporary  files.  If  the  output is big and very compressible this will take up less disk
           space in $TMPDIR and possibly be faster due to less disk I/O.

           GNU parallel will try pzstd, lbzip2, pbzip2, zstd, pigz, lz4, lzop,  plzip,  lzip,  lrz,  gzip,  pxz,
           lzma, bzip2, xz, clzip, in that order, and use the first available.

       --compress-program prg
       --decompress-program prg
           Use  prg  for  (de)compressing  temporary  files.  It  is  assumed that prg -dc will decompress stdin
           (standard input) to stdout (standard output) unless --decompress-program is given.

       --csv
           Treat input as CSV-format. --colsep sets the field delimiter. It works very much like --colsep except
           it deals correctly with quoting:

              echo '"1 big, 2 small","2""x4"" plank",12.34' |
                parallel --csv echo {1} of {2} at {3}

           Even quoted newlines are parsed correctly:

              (echo '"Start of field 1 with newline'
               echo 'Line 2 in field 1";value 2') |
                parallel --csv --colsep ';' echo Field 1: {1} Field 2: {2}

           When used with --pipe only pass full CSV-records.

       --ctag str (alpha testing)
           Color tag. See --tag.

       --ctagstring str (alpha testing)
           Color tagstring. See --tagstring.

       --delay mytime
           Delay starting next job by mytime. GNU parallel will pause mytime after starting each job. mytime  is
           normally in seconds, but can be floats postfixed with s, m, h, or d which would multiply the float by
           1, 60, 3600, or 86400. Thus these are equivalent: --delay 100000 and --delay 1d3.5h16.6m4s.

           If  you  append  'auto'  to  mytime  (e.g. 13m3sauto) GNU parallel will automatically try to find the
           optimal value: If a job fails, mytime is doubled. If a job succeeds, mytime is decreased by 10%.

       --delimiter delim
       -d delim
           Input items are terminated by delim.  Quotes and backslash are not special; every  character  in  the
           input is taken literally.  Disables the end-of-file string, which is treated like any other argument.
           The  specified  delimiter  may  be  characters,  C-style  character  escapes  such as \n, or octal or
           hexadecimal escape codes.  Octal and hexadecimal escape  codes  are  understood  as  for  the  printf
           command.  Multibyte characters are not supported.

       --dirnamereplace replace-str
       --dnr replace-str
           Use the replacement string replace-str instead of {//} for dirname of input line.

       --dry-run
           Print  the  job  to run on stdout (standard output), but do not run the job. Use -v -v to include the
           wrapping that GNU parallel generates (for remote jobs, --tmux, --nice, --pipe, --pipepart, --fifo and
           --cat). Do not count on this literally, though, as the job may be scheduled on  another  computer  or
           the local computer if : is in the list.

       -E eof-str
           Set the end of file string to eof-str.  If the end of file string occurs as a line of input, the rest
           of the input is not read.  If neither -E nor -e is used, no end of file string is used.

       --eof[=eof-str]
       -e[eof-str]
           This  option is a synonym for the -E option.  Use -E instead, because it is POSIX compliant for xargs
           while this option is not.  If eof-str is omitted, there is no end of file string.  If neither -E  nor
           -e is used, no end of file string is used.

       --embed
           Embed  GNU  parallel in a shell script. If you need to distribute your script to someone who does not
           want to install GNU parallel you can embed GNU parallel in your own shell script:

             parallel --embed > new_script

           After which you add your code at the end of new_script. This is tested on ash, bash, dash,  ksh,  sh,
           and zsh.

       --env var
           Copy environment variable var. This will copy var to the environment that the command is run in. This
           is especially useful for remote execution.

           In Bash var can also be a Bash function - just remember to export -f the function, see command.

           The  variable  '_'  is  special.  It will copy all exported environment variables except for the ones
           mentioned in ~/.parallel/ignored_vars.

           To copy the full environment (both exported and not exported variables, arrays,  and  functions)  use
           env_parallel.

           See also: --record-env, --session.

       --eta
           Show  the  estimated  number  of  seconds before finishing. This forces GNU parallel to read all jobs
           before starting to find the number of jobs. GNU parallel normally only reads the next job to run.

           The estimate is based on the runtime of finished jobs, so the first estimate will only be shown  when
           the first job has finished.

           Implies --progress.

           See also: --bar, --progress.

       --fg
           Run command in foreground.

           With --tmux and --tmuxpane GNU parallel will start tmux in the foreground.

           With  --semaphore  GNU  parallel will run the command in the foreground (opposite --bg), and wait for
           completion of the command before exiting.

           See also: --bg, man sem.

       --fifo
           Create a temporary fifo with content. Normally --pipe and --pipepart will give data to the program on
           stdin (standard input). With --fifo GNU parallel will create a temporary fifo with the name in {}, so
           you can do: parallel --pipe --fifo wc {}.

           Beware: If data is not read from the fifo, the job will block forever.

           Implies --pipe unless --pipepart is used.

           See also: --cat.

       --filter filter
           Only run jobs where filter is true. filter can contain replacement strings and Perl code. Example:

              parallel --filter '{1} < {2}+1' echo ::: {1..3} ::: {1..3}

           Outputs: 1,1 1,2 1,3 2,2 2,3 3,3

       --filter-hosts
           Remove down hosts. For each remote host: check that login through ssh works. If not: do not use  this
           host.

           For  performance  reasons, this check is performed only at the start and every time --sshloginfile is
           changed. If an host goes down after the first check, it will go undetected  until  --sshloginfile  is
           changed; --retries can be used to mitigate this.

           Currently  you  can  not put --filter-hosts in a profile, $PARALLEL, /etc/parallel/config or similar.
           This is because GNU parallel uses GNU parallel to compute this, so you will  get  an  infinite  loop.
           This will likely be fixed in a later release.

       --gnu
           Behave like GNU parallel. This option historically took precedence over --tollef. The --tollef option
           is now retired, and therefore may not be used. --gnu is kept for compatibility.

       --group
           Group  output.  Output  from  each  job  is  grouped together and is only printed when the command is
           finished. Stdout (standard output) first followed by stderr (standard error).

           This takes in the order of 0.5ms per job and depends on the speed of your disk for larger output.  It
           can be disabled with -u, but this means output from different commands can get mixed.

           --group is the default. Can be reversed with -u.

           See also: --line-buffer --ungroup

       --group-by val
           Group  input  by  value.  Combined with --pipe/--pipepart --group-by groups lines with the same value
           into a record.

           The value can be computed from the full line or from a single column.

           val can be:

            column number Use the value in the column numbered.

            column name   Treat the first line as a header and use the value in the column named.

                          (Not supported with --pipepart).

            perl expression
                          Run the perl expression and use $_ as the value.

            column number perl expression
                          Put the value of the column put in $_, run the perl expression,  and  use  $_  as  the
                          value.

            column name perl expression
                          Put  the  value  of  the  column put in $_, run the perl expression, and use $_ as the
                          value.

                          (Not supported with --pipepart).

           Example:

             UserID, Consumption
             123,    1
             123,    2
             12-3,   1
             221,    3
             221,    1
             2/21,   5

           If you want to group 123, 12-3, 221, and 2/21 into 4 records and pass one record at a time to wc:

             tail -n +2 table.csv | \
               parallel --pipe --colsep , --group-by 1 -kN1 wc

           Make GNU parallel treat the first line as a header:

             cat table.csv | \
               parallel --pipe --colsep , --header : --group-by 1 -kN1 wc

           Address column by column name:

             cat table.csv | \
               parallel --pipe --colsep , --header : --group-by UserID -kN1 wc

           If 12-3 and 123 are really the same UserID, remove non-digits in UserID when grouping:

             cat table.csv | parallel --pipe --colsep , --header : \
               --group-by 'UserID s/\D//g' -kN1 wc

           See also: --shard, --roundrobin.

       --help
       -h  Print a summary of the options to GNU parallel and exit.

       --halt-on-error val
       --halt val
           When should GNU parallel terminate? In some situations it  makes  no  sense  to  run  all  jobs.  GNU
           parallel should simply give up as soon as a condition is met.

           val defaults to never, which runs all jobs no matter what.

           val can also take on the form of when,why.

           when  can  be 'now' which means kill all running jobs and halt immediately, or it can be 'soon' which
           means wait for all running jobs to complete, but start no new jobs.

           why can be 'fail=X', 'fail=Y%', 'success=X', 'success=Y%', 'done=X', or  'done=Y%'  where  X  is  the
           number  of jobs that has to fail, succeed, or be done before halting, and Y is the percentage of jobs
           that has to fail, succeed, or be done before halting.

           Example:

            --halt now,fail=1     exit when the first job fails. Kill running jobs.

            --halt soon,fail=3    exit when 3 jobs fail, but wait for running jobs to complete.

            --halt soon,fail=3%   exit when 3% of the jobs have failed, but wait for running jobs to complete.

            --halt now,success=1  exit when a job succeeds. Kill running jobs.

            --halt soon,success=3 exit when 3 jobs succeeds, but wait for running jobs to complete.

            --halt now,success=3% exit when 3% of the jobs have succeeded. Kill running jobs.

            --halt now,done=1     exit when one of the jobs finishes. Kill running jobs.

            --halt soon,done=3    exit when 3 jobs finishes, but wait for running jobs to complete.

            --halt now,done=3%    exit when 3% of the jobs have finished. Kill running jobs.

           For backwards compatibility these also work:

           0           never

           1           soon,fail=1

           2           now,fail=1

           -1          soon,success=1

           -2          now,success=1

           1-99%       soon,fail=1-99%

       --header regexp
           Use regexp as header. For normal usage the matched header (typically the first line: --header '.*\n')
           will be split using --colsep (which will default to '\t') and column names can be used as replacement
           variables: {column name}, {column name/}, {column name//}, {column name/.}, {column name.},  {=column
           name perl expression =}, ..

           For --pipe the matched header will be prepended to each output.

           --header : is an alias for --header '.*\n'.

           If regexp is a number, it is a fixed number of lines.

       --hostgroups
       --hgrp
           Enable  hostgroups on arguments. If an argument contains '@' the string after '@' will be removed and
           treated as a list of hostgroups on which this job is allowed to run. If there is no --sshlogin with a
           corresponding group, the job will run on any hostgroup.

           Example:

             parallel --hostgroups \
               --sshlogin @grp1/myserver1 -S @grp1+grp2/myserver2 \
               --sshlogin @grp3/myserver3 \
               echo ::: my_grp1_arg@grp1 arg_for_grp2@grp2 third@grp1+grp3

           my_grp1_arg may be run on either myserver1 or myserver2, third may be  run  on  either  myserver1  or
           myserver3, but arg_for_grp2 will only be run on myserver2.

           See also: --sshlogin, $PARALLEL_HOSTGROUPS, $PARALLEL_ARGHOSTGROUPS.

       -I replace-str
           Use the replacement string replace-str instead of {}.

       --replace[=replace-str]
       -i[replace-str]
           This  option  is  a  synonym  for -Ireplace-str if replace-str is specified, and for -I {} otherwise.
           This option is deprecated; use -I instead.

       --joblog logfile
           Logfile for executed jobs. Save a list of the executed jobs to logfile in the following TAB separated
           format: sequence number, sshlogin, start time as seconds since epoch, run time in seconds,  bytes  in
           files transferred, bytes in files returned, exit status, signal, and command run.

           For --pipe bytes transferred and bytes returned are number of input and output of bytes.

           If logfile is prepended with '+' log lines will be appended to the logfile.

           To convert the times into ISO-8601 strict do:

             cat logfile | perl -a -F"\t" -ne \
               'chomp($F[2]=`date -d \@$F[2] +%FT%T`); print join("\t",@F)'

           If the host is long, you can use column -t to pretty print it:

             cat joblog | column -t

           See also: --resume --resume-failed.

       --jobs N
       -j N
       --max-procs N
       -P N
           Number  of  jobslots  on  each  machine.  Run up to N jobs in parallel.  0 means as many as possible.
           Default is 100% which will run one job per CPU on each machine.

           If --semaphore is set, the default is 1 thus making a mutex.

       --jobs +N
       -j +N
       --max-procs +N
       -P +N
           Add   N   to   the   number   of   CPUs.    Run   this   many   jobs   in   parallel.     See    also
           --use-cores-instead-of-threads and --use-sockets-instead-of-threads.

       --jobs -N
       -j -N
       --max-procs -N
       -P -N
           Subtract N from the number of CPUs.  Run this many jobs in parallel.  If the evaluated number is less
           than    1    then    1    will    be    used.     See    also    --use-cores-instead-of-threads   and
           --use-sockets-instead-of-threads.

       --jobs N%
       -j N%
       --max-procs N%
       -P N%
           Multiply  N%  with  the  number  of   CPUs.    Run   this   many   jobs   in   parallel.   See   also
           --use-cores-instead-of-threads and --use-sockets-instead-of-threads.

       --jobs procfile
       -j procfile
       --max-procs procfile
       -P procfile
           Read  parameter  from  file.  Use  the  content  of procfile as parameter for -j. E.g. procfile could
           contain the string 100% or +2 or 10. If procfile is changed when a job completes,  procfile  is  read
           again  and  the new number of jobs is computed. If the number is lower than before, running jobs will
           be allowed to finish but new jobs will not be started until  the  wanted  number  of  jobs  has  been
           reached.  This makes it possible to change the number of simultaneous running jobs while GNU parallel
           is running.

       --keep-order
       -k  Keep  sequence  of output same as the order of input. Normally the output of a job will be printed as
           soon as the job completes. Try this to see the difference:

             parallel -j4 sleep {}\; echo {} ::: 2 1 4 3
             parallel -j4 -k sleep {}\; echo {} ::: 2 1 4 3

           If used with --onall or --nonall the output will grouped by sshlogin in sorted order.

           If used with --pipe --roundrobin and the same input, the jobslots will get the  same  blocks  in  the
           same order in every run.

           -k only affects the order in which the output is printed - not the order in which jobs are run.

       -L recsize
           When used with --pipe: Read records of recsize.

           When  used  otherwise:  Use  at  most recsize nonblank input lines per command line.  Trailing blanks
           cause an input line to be logically continued on the next input line.

           -L 0 means read one line, but insert 0 arguments on the command line.

           recsize can be postfixed with K, M, G, T, P, k, m, g, t, or p (see UNIT PREFIX).

           Implies -X unless -m, --xargs, or --pipe is set.

       --max-lines[=recsize]
       -l[recsize]
           When used with --pipe: Read records of recsize lines.

           When used otherwise: Synonym for the -L option.  Unlike -L, the recsize  argument  is  optional.   If
           recsize  is  not specified, it defaults to one.  The -l option is deprecated since the POSIX standard
           specifies -L instead.

           -l 0 is an alias for -l 1.

           Implies -X unless -m, --xargs, or --pipe is set.

       --limit "command args"
           Dynamic job limit. Before starting a new job run  command  with  args.  The  exit  value  of  command
           determines what GNU parallel will do:

           0   Below limit. Start another job.

           1   Over limit. Start no jobs.

           2   Way over limit. Kill the youngest job.

           You can use any shell command. There are 3 predefined commands:

           "io n"    Limit  for I/O. The amount of disk I/O will be computed as a value 0-100, where 0 is no I/O
                     and 100 is at least one disk is 100% saturated.

           "load n"  Similar to --load.

           "mem n"   Similar to --memfree.

       --line-buffer
       --lb
           Buffer output on line basis. --group will keep the output together for a whole job. --ungroup  allows
           output  to  mixup  with  half  a  line  coming  from one job and half a line coming from another job.
           --line-buffer fits between these two: GNU parallel will print a full line, but will allow for  mixing
           lines of different jobs.

           --line-buffer  takes  more  CPU  power  than  both --group and --ungroup, but can be much faster than
           --group if the CPU is not the limiting factor.

           Normally --line-buffer does not buffer on disk, and can thus process an infinite amount of data,  but
           it  will  buffer  on  disk when combined with: --keep-order, --results, --compress, and --files. This
           will make it as slow as --group and will limit output to the available disk space.

           With --keep-order --line-buffer will output lines  from  the  first  job  continuously  while  it  is
           running,  then  lines  from the second job while that is running. It will buffer full lines, but jobs
           will not mix. Compare:

             parallel -j0 'echo {};sleep {};echo {}' ::: 1 3 2 4
             parallel -j0 --lb 'echo {};sleep {};echo {}' ::: 1 3 2 4
             parallel -j0 -k --lb 'echo {};sleep {};echo {}' ::: 1 3 2 4

           See also: --group --ungroup

       --xapply
       --link
           Link input sources. Read multiple input sources like xapply. If multiple input sources are given, one
           argument will be read from each of the input sources. The arguments can be accessed in the command as
           {1} .. {n}, so {1} will be a line from the first input source, and {6} will refer to  the  line  with
           the same line number from the 6th input source.

           Compare these two:

             parallel echo {1} {2} ::: 1 2 3 ::: a b c
             parallel --link echo {1} {2} ::: 1 2 3 ::: a b c

           Arguments will be recycled if one input source has more arguments than the others:

             parallel --link echo {1} {2} {3} \
               ::: 1 2 ::: I II III ::: a b c d e f g

           See also --header, :::+, ::::+.

       --load max-load
           Do  not  start new jobs on a given computer unless the number of running processes on the computer is
           less than max-load. max-load uses the same syntax as --jobs, so 100% for  one  per  CPU  is  a  valid
           setting. Only difference is 0 which is interpreted as 0.01.

       --controlmaster
       -M  Use  ssh's  ControlMaster to make ssh connections faster. Useful if jobs run remote and are very fast
           to run. This is disabled for sshlogins that specify their own ssh command.

       -m  Multiple arguments. Insert as many arguments as the command line length permits. If multiple jobs are
           being run in parallel: distribute the arguments evenly among the jobs. Use -j1 or  --xargs  to  avoid
           this.

           If  {}  is not used the arguments will be appended to the line.  If {} is used multiple times each {}
           will be replaced with all the arguments.

           Support for -m with --sshlogin is limited and may fail.

           See also -X for context replace. If in doubt use -X as that will most likely do what is needed.

       --memfree size
           Minimum memory free when starting another job. The size can be postfixed with K, M, G, T, P, k, m, g,
           t, or p (see UNIT PREFIX).

           If the jobs take up very different amount of RAM, GNU parallel will only start as many  as  there  is
           memory  for.  If  less  than size bytes are free, no more jobs will be started. If less than 50% size
           bytes are free, the youngest job will be killed, and put back on the queue to be run later.

           --retries must be set to determine how many times GNU parallel should retry a given job.

           See also: --memsuspend

       --memsuspend size
           Suspend jobs when there is less than 2 * size memory free. The size can be postfixed with K, M, G, T,
           P, k, m, g, t, or p (see UNIT PREFIX).

           If the available memory falls below 2 * size, GNU parallel will suspend some of the running jobs.  If
           the available memory falls below size, only one job will be running.

           If  a  single job takes up at most size RAM, all jobs will complete without running out of memory. If
           you have swap available, you can usually lower size to around half the size of a single  job  -  with
           the slight risk of swapping a little.

           Jobs will be resumed when more RAM is available - typically when the oldest job completes.

           --memsuspend only works on local jobs because there is no obvious way to suspend remote jobs.

           See also: --memfree

       --minversion version
           Print the version GNU parallel and exit.  If the current version of GNU parallel is less than version
           the exit code is 255. Otherwise it is 0.

           This  is  useful  for  scripts  that  depend on features only available from a certain version of GNU
           parallel.

       --max-args=max-args
       -n max-args
           Use at most max-args arguments per command line.  Fewer than max-args arguments will be used  if  the
           size  (see the -s option) is exceeded, unless the -x option is given, in which case GNU parallel will
           exit.

           -n 0 means read one argument, but insert 0 arguments on the command line.

           max-args can be postfixed with K, M, G, T, P, k, m, g, t, or p (see UNIT PREFIX).

           Implies -X unless -m is set.

       --max-replace-args=max-args
       -N max-args
           Use at most max-args arguments per command line. Like -n but also makes replacement  strings  {1}  ..
           {max-args} that represents argument 1 .. max-args. If too few args the {n} will be empty.

           -N 0 means read one argument, but insert 0 arguments on the command line.

           This will set the owner of the homedir to the user:

             tr ':' '\n' < /etc/passwd | parallel -N7 chown {1} {6}

           Implies -X unless -m or --pipe is set.

           max-args can be postfixed with K, M, G, T, P, k, m, g, t, or p (see UNIT PREFIX).

           When used with --pipe -N is the number of records to read. This is somewhat slower than --block.

       --nonall
           --onall  with  no  arguments.  Run  the  command  on  all computers given with --sshlogin but take no
           arguments. GNU parallel will log into --jobs number of computers in parallel and run the job  on  the
           computer. -j adjusts how many computers to log into in parallel.

           This is useful for running the same command (e.g. uptime) on a list of servers.

       --onall
           Run  all the jobs on all computers given with --sshlogin. GNU parallel will log into --jobs number of
           computers in parallel and run one job at a time on the computer. The order of the jobs  will  not  be
           changed, but some computers may finish before others.

           When  using --group the output will be grouped by each server, so all the output from one server will
           be grouped together.

           --joblog will contain an entry for each job on each server, so there will be several job sequence 1.

       --output-as-files
       --outputasfiles
       --files
           Instead of printing the output to stdout (standard output) the output of each job is saved in a  file
           and the filename is then printed.

           See also: --results

       --pipe
       --spreadstdin
           Spread  input to jobs on stdin (standard input). Read a block of data from stdin (standard input) and
           give one block of data as input to one job.

           The block size is determined by --block. The strings --recstart and --recend tell GNU parallel how  a
           record starts and/or ends. The block read will have the final partial record removed before the block
           is passed on to the job. The partial record will be prepended to next block.

           If --recstart is given this will be used to split at record start.

           If --recend is given this will be used to split at record end.

           If both --recstart and --recend are given both will have to match to find a split position.

           If  neither  --recstart nor --recend are given --recend defaults to '\n'. To have no record separator
           use --recend "".

           --files is often used with --pipe.

           --pipe maxes out at around 1 GB/s input, and  100  MB/s  output.  If  performance  is  important  use
           --pipepart.

           See also: --recstart, --recend, --fifo, --cat, --pipepart, --files.

       --pipepart
           Pipe parts of a physical file. --pipepart works similar to --pipe, but is much faster.

           --pipepart has a few limitations:

           •  The  file  must  be  a normal file or a block device (technically it must be seekable) and must be
              given using -a or ::::. The file cannot be a pipe, a fifo, or a stream as they are not seekable.

              If using a block device with lot of NUL bytes, remember to set --recend ''.

           •  Record counting (-N) and line counting (-L/-l) do not work. Instead use --recstart and --recend to
              determine where records end.

       --plain
           Ignore any --profile, $PARALLEL, and ~/.parallel/config to get full control on the command line (used
           by GNU parallel internally when called with --sshlogin).

       --plus
           Activate additional replacement strings: {+/} {+.} {+..} {+...} {..} {...}  {/..}  {/...}  {##}.  The
           idea  being  that  '{+foo}'  matches  the  opposite  of  '{foo}'  and  {}  =  {+/}/{/}  =  {.}.{+.} =
           {+/}/{/.}.{+.} = {..}.{+..} = {+/}/{/..}.{+..} = {...}.{+...} = {+/}/{/...}.{+...}

           {##} is the total number of jobs to be run. It is incompatible with -X/-m/--xargs.

           {0%} zero-padded jobslot.

           {0#} zero-padded sequence number.

           {choose_k} is inspired by n choose k: Given a list of n elements, choose k. k is the number of  input
           sources  and  n is the number of arguments in an input source.  The content of the input sources must
           be the same and the arguments must be unique.

           Shorthands for variables:

             {slot}        $PARALLEL_JOBSLOT (see {%})
             {sshlogin}    $PARALLEL_SSHLOGIN
             {host}        $PARALLEL_SSHHOST
             {agrp}        $PARALLEL_ARGHOSTGROUPS
             {hgrp}        $PARALLEL_HOSTGROUPS

           The following dynamic replacement strings are also activated. They are inspired by  bash's  parameter
           expansion:

             {:-str}       str if the value is empty
             {:num}        remove the first num characters
             {:num1:num2}  characters from num1 to num2
             {#regexp}     remove prefix regexp (non-greedy)
             {##regexp}    remove prefix regexp (greedy)
             {%regexp}     remove postfix regexp (non-greedy)
             {%%regexp}    remove postfix regexp (greedy)
             {/regexp/str} replace regexp with str
             {^str}        uppercase str if found at the start
             {^^str}       uppercase str
             {,str}        lowercase str if found at the start
             {,,str}       lowercase str

       --progress
           Show  progress  of computations. List the computers involved in the task with number of CPUs detected
           and the max number of jobs to run. After that show progress for  each  computer:  number  of  running
           jobs, number of completed jobs, and percentage of all jobs done by this computer. The percentage will
           only  be  available  after  all  jobs have been scheduled as GNU parallel only read the next job when
           ready to schedule it - this is to avoid wasting time and memory by reading everything at startup.

           By sending GNU parallel SIGUSR2 you can toggle turning on/off --progress on a  running  GNU  parallel
           process.

           See also: --eta and --bar.

       --max-line-length-allowed
           Print  the  maximal  number  of characters allowed on the command line and exit (used by GNU parallel
           itself to determine the line length on remote computers).

       --number-of-cpus (obsolete)
           Print the number of physical CPU cores and exit.

       --number-of-cores
           Print the number of physical CPU cores and exit (used by GNU parallel itself to determine the  number
           of physical CPU cores on remote computers).

       --number-of-sockets
           Print  the number of filled CPU sockets and exit (used by GNU parallel itself to determine the number
           of filled CPU sockets on remote computers).

       --number-of-threads
           Print the number of hyperthreaded CPU cores and exit (used by GNU parallel itself  to  determine  the
           number of hyperthreaded CPU cores on remote computers).

       --no-keep-order
           Overrides an earlier --keep-order (e.g. if set in ~/.parallel/config).

       --nice niceness
           Run the command at this niceness.

           By default GNU parallel will run jobs at the same nice level as GNU parallel is started - both on the
           local machine and remote servers, so you are unlikely to ever use this option.

           Setting  --nice  will  override  this  nice level. If the nice level is smaller than the current nice
           level, it will only affect remote jobs (e.g. if current level is 10 then --nice 5  will  cause  local
           jobs to be run at level 10, but remote jobs run at nice level 5).

       --interactive
       -p  Prompt  the  user about whether to run each command line and read a line from the terminal.  Only run
           the command line if the response starts with 'y' or 'Y'.  Implies -t.

       --parens parensstring
           Define start and end parenthesis for {= perl expression =}. The left and the right parenthesis can be
           multiple characters and are assumed to be the same length. The default is {==} giving {= as the start
           parenthesis and =} as the end parenthesis.

           Another useful setting is ,,,, which would make both parenthesis ,,:

             parallel --parens ,,,, echo foo is ,,s/I/O/g,, ::: FII

           See also: --rpl {= perl expression =}

       --profile profilename
       -J profilename
           Use profile profilename for options. This is useful if you want to have multiple profiles. You  could
           have  one  profile  for  running  jobs  in parallel on the local computer and a different profile for
           running jobs on remote computers. See the section PROFILE FILES for examples.

           profilename corresponds to the file ~/.parallel/profilename.

           You can give multiple profiles by repeating --profile. If parts of the profiles conflict,  the  later
           ones will be used.

           Default: config

       --quote
       -q  Quote  command.  If  your  command  contains special characters that should not be interpreted by the
           shell (e.g. ; \ | *), use --quote to escape these. The command must be  a  simple  command  (see  man
           bash) without redirections and without variable assignments.

           See the section QUOTING. Most people will not need this.  Quoting is disabled by default.

       --no-run-if-empty
       -r  If the stdin (standard input) only contains whitespace, do not run the command.

           If used with --pipe this is slow.

       --noswap
           Do not start new jobs on a given computer if there is both swap-in and swap-out activity.

           The swap activity is only sampled every 10 seconds as the sampling takes 1 second to do.

           Swap  activity is computed as (swap-in)*(swap-out) which in practice is a good value: swapping out is
           not a problem, swapping in is not a problem, but  both  swapping  in  and  out  usually  indicates  a
           problem.

           --memfree and --memsuspend may give better results, so try using those first.

       --record-env
           Record  current  environment variables in ~/.parallel/ignored_vars. This is useful before using --env
           _.

           See also: --env, --session.

       --recstart startstring
       --recend endstring
           If --recstart is given startstring will be used to split at record start.

           If --recend is given endstring will be used to split at record end.

           If both --recstart and --recend are given the combined string endstringstartstring will have to match
           to find a split position. This is useful if either startstring or endstring match in the middle of  a
           record.

           If  neither  --recstart  nor  --recend  are  given  then --recend defaults to '\n'. To have no record
           separator use --recend "".

           --recstart and --recend are used with --pipe.

           Use --regexp to interpret --recstart and --recend as regular expressions. This is slow, however.

       --regexp
           Use --regexp to interpret --recstart and --recend as regular expressions. This is slow, however.

       --remove-rec-sep
       --removerecsep
       --rrs
           Remove the text matched by --recstart and --recend before piping it to the command.

           Only used with --pipe.

       --results name (beta testing)
       --res name (beta testing)
           Save the output into files.

           Simple string output dir

           If name does not contain replacement strings and does not end in .csv/.tsv, the output will be stored
           in a directory tree rooted at name.  Within this directory tree, each command will  result  in  three
           files:  name/<ARGS>/stdout  and  name/<ARGS>/stderr,  name/<ARGS>/seq,  where <ARGS> is a sequence of
           directories representing the header of the input source (if using --header :) or the  number  of  the
           input source and corresponding values.

           E.g:

             parallel --header : --results foo echo {a} {b} \
               ::: a I II ::: b III IIII

           will generate the files:

             foo/a/II/b/III/seq
             foo/a/II/b/III/stderr
             foo/a/II/b/III/stdout
             foo/a/II/b/IIII/seq
             foo/a/II/b/IIII/stderr
             foo/a/II/b/IIII/stdout
             foo/a/I/b/III/seq
             foo/a/I/b/III/stderr
             foo/a/I/b/III/stdout
             foo/a/I/b/IIII/seq
             foo/a/I/b/IIII/stderr
             foo/a/I/b/IIII/stdout

           and

             parallel --results foo echo {1} {2} ::: I II ::: III IIII

           will generate the files:

             foo/1/II/2/III/seq
             foo/1/II/2/III/stderr
             foo/1/II/2/III/stdout
             foo/1/II/2/IIII/seq
             foo/1/II/2/IIII/stderr
             foo/1/II/2/IIII/stdout
             foo/1/I/2/III/seq
             foo/1/I/2/III/stderr
             foo/1/I/2/III/stdout
             foo/1/I/2/IIII/seq
             foo/1/I/2/IIII/stderr
             foo/1/I/2/IIII/stdout

           CSV file output

           If name ends in .csv/.tsv the output will be a CSV-file named name.

           .csv gives a comma separated value file. .tsv gives a TAB separated value file.

           -.csv/-.tsv are special: It will give the file on stdout (standard output).

           JSON file output

           If name ends in .json the output will be a JSON-file named name.

           -.json is special: It will give the file on stdout (standard output).

           Replacement string output file

           If  name  contains  a replacement string and the replaced result does not end in /, then the standard
           output will be stored in a file named by this result. Standard error will be stored in the same  file
           name  with  '.err'  added,  and  the sequence number will be stored in the same file name with '.seq'
           added.

           E.g.

             parallel --results my_{} echo ::: foo bar baz

           will generate the files:

             my_bar
             my_bar.err
             my_bar.seq
             my_baz
             my_baz.err
             my_baz.seq
             my_foo
             my_foo.err
             my_foo.seq

           Replacement string output dir

           If name contains a replacement string and the replaced result ends in /, then output  files  will  be
           stored in the resulting dir.

           E.g.

             parallel --results my_{}/ echo ::: foo bar baz

           will generate the files:

             my_bar/seq
             my_bar/stderr
             my_bar/stdout
             my_baz/seq
             my_baz/stderr
             my_baz/stdout
             my_foo/seq
             my_foo/stderr
             my_foo/stdout

           See also: --files, --tag, --header, --joblog.

       --resume
           Resumes  from  the  last  unfinished  job. By reading --joblog or the --results dir GNU parallel will
           figure out the last unfinished job and continue from  there.  As  GNU  parallel  only  looks  at  the
           sequence  numbers in --joblog then the input, the command, and --joblog all have to remain unchanged;
           otherwise GNU parallel may run wrong commands.

           See also: --joblog, --results, --resume-failed, --retries.

       --resume-failed
           Retry all failed and resume from the last unfinished job.  By  reading  --joblog  GNU  parallel  will
           figure  out  the  failed  jobs and run those again. After that it will resume last unfinished job and
           continue from there. As GNU parallel only looks at the sequence numbers in --joblog then  the  input,
           the  command,  and  --joblog  all  have  to  remain  unchanged;  otherwise GNU parallel may run wrong
           commands.

           See also: --joblog, --resume, --retry-failed, --retries.

       --retry-failed
           Retry all failed jobs in joblog. By reading --joblog GNU parallel will figure out the failed jobs and
           run those again.

           --retry-failed ignores the command and arguments on the command line: It only looks at the joblog.

           Differences between --resume, --resume-failed, --retry-failed

           In this example exit {= $_%=2 =} will cause every other job to fail.

             timeout -k 1 4 parallel --joblog log -j10 \
               'sleep {}; exit {= $_%=2 =}' ::: {10..1}

           4 jobs completed. 2 failed:

             Seq   [...]   Exitval Signal  Command
             10    [...]   1       0       sleep 1; exit 1
             9     [...]   0       0       sleep 2; exit 0
             8     [...]   1       0       sleep 3; exit 1
             7     [...]   0       0       sleep 4; exit 0

           --resume does not care about the Exitval, but only looks at Seq. If the Seq is run, it  will  not  be
           run again. So if needed, you can change the command for the seqs not run yet:

             parallel --resume --joblog log -j10 \
               'sleep .{}; exit {= $_%=2 =}' ::: {10..1}

             Seq   [...]   Exitval Signal  Command
             [... as above ...]
             1     [...]   0       0       sleep .10; exit 0
             6     [...]   1       0       sleep .5; exit 1
             5     [...]   0       0       sleep .6; exit 0
             4     [...]   1       0       sleep .7; exit 1
             3     [...]   0       0       sleep .8; exit 0
             2     [...]   1       0       sleep .9; exit 1

           --resume-failed  cares  about the Exitval, but also only looks at Seq to figure out which commands to
           run. Again this means you can change the command, but not the arguments. It will run the failed  seqs
           and the seqs not yet run:

             parallel --resume-failed --joblog log -j10 \
               'echo {};sleep .{}; exit {= $_%=3 =}' ::: {10..1}

             Seq   [...]   Exitval Signal  Command
             [... as above ...]
             10    [...]   1       0       echo 1;sleep .1; exit 1
             8     [...]   0       0       echo 3;sleep .3; exit 0
             6     [...]   2       0       echo 5;sleep .5; exit 2
             4     [...]   1       0       echo 7;sleep .7; exit 1
             2     [...]   0       0       echo 9;sleep .9; exit 0

           --retry-failed  cares  about  the  Exitval,  but  takes  the  command from the joblog. It ignores any
           arguments or commands given on the command line:

             parallel --retry-failed --joblog log -j10 this part is ignored

             Seq   [...]   Exitval Signal  Command
             [... as above ...]
             10    [...]   1       0       echo 1;sleep .1; exit 1
             6     [...]   2       0       echo 5;sleep .5; exit 2
             4     [...]   1       0       echo 7;sleep .7; exit 1

           See also: --joblog, --resume, --resume-failed, --retries.

       --retries n
           If a job fails, retry it on another computer on which it has not failed. Do this n  times.  If  there
           are  fewer  than n computers in --sshlogin GNU parallel will re-use all the computers. This is useful
           if some jobs fail for no apparent reason (such as network failure).

       --return filename
           Transfer files from remote computers. --return is used with --sshlogin when the arguments  are  files
           on  the  remote  computers.  When  processing  is done the file filename will be transferred from the
           remote computer using rsync and will be put relative to the default login dir. E.g.

             echo foo/bar.txt | parallel --return {.}.out \
               --sshlogin server.example.com touch {.}.out

           This will transfer the file $HOME/foo/bar.out  from  the  computer  server.example.com  to  the  file
           foo/bar.out after running touch foo/bar.out on server.example.com.

             parallel -S server --trc out/./{}.out touch {}.out ::: in/file

           This  will  transfer  the  file  in/file.out  from  the  computer  server.example.com  to  the  files
           out/in/file.out after running touch in/file.out on server.

             echo /tmp/foo/bar.txt | parallel --return {.}.out \
               --sshlogin server.example.com touch {.}.out

           This will transfer the file  /tmp/foo/bar.out  from  the  computer  server.example.com  to  the  file
           /tmp/foo/bar.out after running touch /tmp/foo/bar.out on server.example.com.

           Multiple files can be transferred by repeating the option multiple times:

             echo /tmp/foo/bar.txt | parallel \
               --sshlogin server.example.com \
               --return {.}.out --return {.}.out2 touch {.}.out {.}.out2

           --return is often used with --transferfile and --cleanup.

           --return is ignored when used with --sshlogin : or when not used with --sshlogin.

           For details on transferring see --transferfile.

       --round-robin
       --round
           Normally  --pipe  will  give  a  single  block to each instance of the command. With --roundrobin all
           blocks will at random be written to commands already running. This is useful if the command  takes  a
           long time to initialize.

           --keep-order  will  not  work  with  --roundrobin  as  it  is  impossible  to track which input block
           corresponds to which output.

           --roundrobin implies --pipe, except if --pipepart is given.

           See also: --group-by, --shard.

       --rpl 'tag perl expression'
           Use tag as a replacement string for perl expression. This  makes  it  possible  to  define  your  own
           replacement strings. GNU parallel's 7 replacement strings are implemented as:

             --rpl '{} '
             --rpl '{#} 1 $_=$job->seq()'
             --rpl '{%} 1 $_=$job->slot()'
             --rpl '{/} s:.*/::'
             --rpl '{//} $Global::use{"File::Basename"} ||=
               eval "use File::Basename; 1;"; $_ = dirname($_);'
             --rpl '{/.} s:.*/::; s:\.[^/.]+$::;'
             --rpl '{.} s:\.[^/.]+$::'

           The --plus replacement strings are implemented as:

             --rpl '{+/} s:/[^/]*$::'
             --rpl '{+.} s:.*\.::'
             --rpl '{+..} s:.*\.([^.]*\.):$1:'
             --rpl '{+...} s:.*\.([^.]*\.[^.]*\.):$1:'
             --rpl '{..} s:\.[^/.]+$::; s:\.[^/.]+$::'
             --rpl '{...} s:\.[^/.]+$::; s:\.[^/.]+$::; s:\.[^/.]+$::'
             --rpl '{/..} s:.*/::; s:\.[^/.]+$::; s:\.[^/.]+$::'
             --rpl '{/...} s:.*/::;s:\.[^/.]+$::;s:\.[^/.]+$::;s:\.[^/.]+$::'
             --rpl '{##} $_=total_jobs()'
             --rpl '{:-(.+?)} $_ ||= $$1'
             --rpl '{:(\d+?)} substr($_,0,$$1) = ""'
             --rpl '{:(\d+?):(\d+?)} $_ = substr($_,$$1,$$2);'
             --rpl '{#([^#].*?)} s/^$$1//;'
             --rpl '{%(.+?)} s/$$1$//;'
             --rpl '{/(.+?)/(.*?)} s/$$1/$$2/;'
             --rpl '{^(.+?)} s/^($$1)/uc($1)/e;'
             --rpl '{^^(.+?)} s/($$1)/uc($1)/eg;'
             --rpl '{,(.+?)} s/^($$1)/lc($1)/e;'
             --rpl '{,,(.+?)} s/($$1)/lc($1)/eg;'

           If  the  user  defined  replacement  string  starts  with  '{'  it  can  also be used as a positional
           replacement string (like {2.}).

           It is recommended to only change $_ but you have full  access  to  all  of  GNU  parallel's  internal
           functions and data structures.

           Here are a few examples:

             Is the job sequence even or odd?
             --rpl '{odd} $_ = seq() % 2 ? "odd" : "even"'
             Pad job sequence with leading zeros to get equal width
             --rpl '{0#} $f=1+int("".(log(total_jobs())/log(10)));
               $_=sprintf("%0${f}d",seq())'
             Job sequence counting from 0
             --rpl '{#0} $_ = seq() - 1'
             Job slot counting from 2
             --rpl '{%1} $_ = slot() + 1'
             Remove all extensions
             --rpl '{:} s:(\.[^/]+)*$::'

           You  can  have  dynamic  replacement  strings  by including parenthesis in the replacement string and
           adding a regular expression between the parenthesis. The matching string will be inserted as $$1:

             parallel --rpl '{%(.*?)} s/$$1//' echo {%.tar.gz} ::: my.tar.gz
             parallel --rpl '{:%(.+?)} s:$$1(\.[^/]+)*$::' \
               echo {:%_file} ::: my_file.tar.gz
             parallel -n3 --rpl '{/:%(.*?)} s:.*/(.*)$$1(\.[^/]+)*$:$1:' \
               echo job {#}: {2} {2.} {3/:%_1} ::: a/b.c c/d.e f/g_1.h.i

           You can even use multiple matches:

             parallel --rpl '{/(.+?)/(.*?)} s/$$1/$$2/;'
               echo {/replacethis/withthis} {/b/C} ::: a_replacethis_b

             parallel --rpl '{(.*?)/(.*?)} $_="$$2$_$$1"' \

               echo {swap/these} ::: -middle-
           See also: {= perl expression =} --parens

       --rsync-opts options
           Options to pass on to rsync. Setting --rsync-opts  takes  precedence  over  setting  the  environment
           variable $PARALLEL_RSYNC_OPTS.

       --max-chars=max-chars
       -s max-chars
           Use  at  most  max-chars characters per command line, including the command and initial-arguments and
           the terminating nulls at the ends of the argument strings.  The  largest  allowed  value  is  system-
           dependent,  and  is  calculated  as  the  argument  length  limit  for  exec,  less  the size of your
           environment.  The default value is the maximum.

           max-chars can be postfixed with K, M, G, T, P, k, m, g, t, or p (see UNIT PREFIX).

           Implies -X unless -m is set.

       --show-limits
           Display the limits on the command-line length which are imposed by the operating system  and  the  -s
           option.   Pipe the input from /dev/null (and perhaps specify --no-run-if-empty) if you don't want GNU
           parallel to do anything.

       --semaphore
           Work as a counting semaphore. --semaphore will cause GNU parallel to start command in the background.
           When the number of jobs given by --jobs is reached, GNU parallel  will  wait  for  one  of  these  to
           complete before starting another command.

           --semaphore implies --bg unless --fg is specified.

           --semaphore implies --semaphorename `tty` unless --semaphorename is specified.

           Used with --fg, --wait, and --semaphorename.

           The command sem is an alias for parallel --semaphore.

           See also: man sem.

       --semaphorename name
       --id name
           Use name as the name of the semaphore. Default is the name of the controlling tty (output from tty).

           The default normally works as expected when used interactively, but when used in a script name should
           be set. $$ or my_task_name are often a good value.

           The semaphore is stored in ~/.parallel/semaphores/

           Implies --semaphore.

           See also: man sem.

       --semaphoretimeout secs
       --st secs
           If secs > 0: If the semaphore is not released within secs seconds, take it anyway.

           If secs < 0: If the semaphore is not released within secs seconds, exit.

           Implies --semaphore.

           See also: man sem.

       --seqreplace replace-str
           Use the replacement string replace-str instead of {#} for job sequence number.

       --session
           Record names in current environment in $PARALLEL_IGNORED_NAMES and exit. Only used with env_parallel.
           Aliases, functions, and variables with names in $PARALLEL_IGNORED_NAMES will not be copied.

           Only supported in Ash, Bash, Dash, Ksh, Sh, and Zsh.

           See also: --env, --record-env.

       --shard shardexpr
           Use shardexpr as shard key and shard input to the jobs.

           shardexpr  is  [column  number|column  name]  [perlexpression]  e.g.  3,  Address, 3 $_%=100, Address
           s/\d//g.

           Each input line is split using --colsep. The value of the column is put into $_, the perl  expression
           is  executed,  the  resulting value is hashed so that all lines of a given value is given to the same
           job slot.

           This is similar to sharding in databases.

           The performance is in the order of 100K rows per second. Faster  if  the  shardcol  is  small  (<10),
           slower if it is big (>100).

           --shard requires --pipe and a fixed numeric value for --jobs.

           See also: --bin, --group-by, --roundrobin.

       --shebang
       --hashbang
           GNU  parallel  can  be called as a shebang (#!) command as the first line of a script. The content of
           the file will be treated as inputsource.

           Like this:

             #!/usr/bin/parallel --shebang -r wget

             https://ftpmirror.gnu.org/parallel/parallel-20120822.tar.bz2
             https://ftpmirror.gnu.org/parallel/parallel-20130822.tar.bz2
             https://ftpmirror.gnu.org/parallel/parallel-20140822.tar.bz2

           --shebang must be set as the first option.

           On FreeBSD env is needed:

             #!/usr/bin/env -S parallel --shebang -r wget

             https://ftpmirror.gnu.org/parallel/parallel-20120822.tar.bz2
             https://ftpmirror.gnu.org/parallel/parallel-20130822.tar.bz2
             https://ftpmirror.gnu.org/parallel/parallel-20140822.tar.bz2

           There are many limitations of shebang (#!)  depending  on  your  operating  system.  See  details  on
           https://www.in-ulm.de/~mascheck/various/shebang/

       --shebang-wrap
           GNU  parallel  can  parallelize  scripts by wrapping the shebang line. If the program can be run like
           this:

             cat arguments | parallel the_program

           then the script can be changed to:

             #!/usr/bin/parallel --shebang-wrap /original/parser --options

           E.g.

             #!/usr/bin/parallel --shebang-wrap /usr/bin/python

           If the program can be run like this:

             cat data | parallel --pipe the_program

           then the script can be changed to:

             #!/usr/bin/parallel --shebang-wrap --pipe /orig/parser --opts

           E.g.

             #!/usr/bin/parallel --shebang-wrap --pipe /usr/bin/perl -w

           --shebang-wrap must be set as the first option.

       --shellquote
           Does not run the command but quotes it. Useful for making quoted composed commands for GNU parallel.

           Multiple --shellquote with quote the string multiple  times,  so  parallel  --shellquote  |  parallel
           --shellquote can be written as parallel --shellquote --shellquote.

       --shuf
           Shuffle  jobs.  When having multiple input sources it is hard to randomize jobs. --shuf will generate
           all jobs, and shuffle them before running them. This is useful to get a quick preview of the  results
           before running the full batch.

       --skip-first-line
           Do not use the first line of input (used by GNU parallel itself when called with --shebang).

       --sql DBURL (obsolete)
           Use --sqlmaster instead.

       --sqlmaster DBURL
           Submit  jobs  via SQL server. DBURL must point to a table, which will contain the same information as
           --joblog, the values from the input sources (stored in columns V1 .. Vn), and the output  (stored  in
           columns Stdout and Stderr).

           If  DBURL  is  prepended  with  '+'  GNU  parallel assumes the table is already made with the correct
           columns and appends the jobs to it.

           If DBURL is not prepended with '+' the table will be dropped and created with the correct  amount  of
           V-columns unless

           --sqlmaster  does  not  run  any  jobs, but it creates the values for the jobs to be run. One or more
           --sqlworker must be run to actually execute the jobs.

           If --wait is set, GNU parallel will wait for the jobs to complete.

           The format of a DBURL is:

             [sql:]vendor://[[user][:pwd]@][host][:port]/[db]/table

           E.g.

             sql:mysql://hr:hr@localhost:3306/hrdb/jobs
             mysql://scott:tiger@my.example.com/pardb/paralleljobs
             sql:oracle://scott:tiger@ora.example.com/xe/parjob
             postgresql://scott:tiger@pg.example.com/pgdb/parjob
             pg:///parjob
             sqlite3:///%2Ftmp%2Fpardb.sqlite/parjob
             csv:///%2Ftmp%2Fpardb/parjob

           Notice how / in the path of sqlite and CVS must be encoded as %2F. Except the last  /  in  CSV  which
           must be a /.

           It can also be an alias from ~/.sql/aliases:

             :myalias mysql:///mydb/paralleljobs

       --sqlandworker DBURL
           Shorthand for: --sqlmaster DBURL --sqlworker DBURL.

       --sqlworker DBURL
           Execute jobs via SQL server. Read the input sources variables from the table pointed to by DBURL. The
           command on the command line should be the same as given by --sqlmaster.

           If you have more than one --sqlworker jobs may be run more than once.

           If  --sqlworker  runs on the local machine, the hostname in the SQL table will not be ':' but instead
           the hostname of the machine.

       --ssh sshcommand
           GNU parallel defaults to using ssh for remote access. This can be overridden with --ssh. It can  also
           be set on a per server basis (see --sshlogin).

       --sshdelay mytime
           Delay starting next ssh by mytime. GNU parallel will not start another ssh for the next mytime.

           For details on mytime see --delay.

       -S [@hostgroups/][ncpus/]sshlogin[,[@hostgroups/][ncpus/]sshlogin[,...]]
       -S @hostgroup
       --sshlogin [@hostgroups/][ncpus/]sshlogin[,[@hostgroups/][ncpus/]sshlogin[,...]]
       --sshlogin @hostgroup
           Distribute jobs to remote computers. The jobs will be run on a list of remote computers.

           If  hostgroups  is  given,  the  sshlogin  will  be  added to that hostgroup. Multiple hostgroups are
           separated by '+'. The sshlogin will always be added to a hostgroup named the same as sshlogin.

           If only the @hostgroup is given, only  the  sshlogins  in  that  hostgroup  will  be  used.  Multiple
           @hostgroup can be given.

           GNU  parallel will determine the number of CPUs on the remote computers and run the number of jobs as
           specified by -j.  If the number ncpus is given GNU parallel will use this number for number  of  CPUs
           on the host. Normally ncpus will not be needed.

           An sshlogin is of the form:

             [sshcommand [options]] [username@]hostname

           The sshlogin must not require a password (ssh-agent, ssh-copy-id, and sshpass may help with that).

           The sshlogin ':' is special, it means 'no ssh' and will therefore run on the local computer.

           The    sshlogin   '..'   is   special,   it   read   sshlogins   from   ~/.parallel/sshloginfile   or
           $XDG_CONFIG_HOME/parallel/sshloginfile

           The sshlogin '-' is special, too, it read sshlogins from stdin (standard input).

           To specify more sshlogins separate the sshlogins by comma, newline (in the same  string),  or  repeat
           the options multiple times.

           For examples: see --sshloginfile.

           The remote host must have GNU parallel installed.

           --sshlogin is known to cause problems with -m and -X.

           --sshlogin is often used with --transferfile, --return, --cleanup, and --trc.

       --sshloginfile filename
       --slf filename
           File with sshlogins. The file consists of sshlogins on separate lines. Empty lines and lines starting
           with '#' are ignored. Example:

             server.example.com
             username@server2.example.com
             8/my-8-cpu-server.example.com
             2/my_other_username@my-dualcore.example.net
             # This server has SSH running on port 2222
             ssh -p 2222 server.example.net
             4/ssh -p 2222 quadserver.example.net
             # Use a different ssh program
             myssh -p 2222 -l myusername hexacpu.example.net
             # Use a different ssh program with default number of CPUs
             //usr/local/bin/myssh -p 2222 -l myusername hexacpu
             # Use a different ssh program with 6 CPUs
             6//usr/local/bin/myssh -p 2222 -l myusername hexacpu
             # Assume 16 CPUs on the local computer
             16/:
             # Put server1 in hostgroup1
             @hostgroup1/server1
             # Put myusername@server2 in hostgroup1+hostgroup2
             @hostgroup1+hostgroup2/myusername@server2
             # Force 4 CPUs and put 'ssh -p 2222 server3' in hostgroup1
             @hostgroup1/4/ssh -p 2222 server3

           When using a different ssh program the last argument must be the hostname.

           Multiple --sshloginfile are allowed.

           GNU  parallel  will  first  look  for  the file in current dir; if that fails it look for the file in
           ~/.parallel.

           The sshloginfile '..' is special, it read sshlogins from ~/.parallel/sshloginfile

           The sshloginfile '.' is special, it read sshlogins from /etc/parallel/sshloginfile

           The sshloginfile '-' is special, too, it read sshlogins from stdin (standard input).

           If the sshloginfile is changed it will be re-read when a job finishes though at most once per second.
           This makes it possible to add and remove hosts while running.

           This can be used to have a daemon that updates the sshloginfile to only contain servers that are up:

               cp original.slf tmp2.slf
               while [ 1 ] ; do
                 nice parallel --nonall -j0 -k --slf original.slf \
                   --tag echo | perl 's/\t$//' > tmp.slf
                 if diff tmp.slf tmp2.slf; then
                   mv tmp.slf tmp2.slf
                 fi
                 sleep 10
               done &
               parallel --slf tmp2.slf ...

       --slotreplace replace-str
           Use the replacement string replace-str instead of {%} for job slot number.

       --silent
           Silent.  The job to be run will not be printed. This is the default.  Can be reversed with -v.

       --template file=repl
       --tmpl file=repl
           Copy file to repl. All replacement strings in the contents of file will be replaced. All  replacement
           strings in the name repl will be replaced.

           With --cleanup the new file will be removed when the job is done.

           If my.tmpl contains this:

             Xval: {x}
             Yval: {y}
             FixedValue: 9
             # x with 2 decimals
             DecimalX: {=x $_=sprintf("%.2f",$_) =}
             TenX: {=x $_=$_*10 =}
             RandomVal: {=1 $_=rand() =}

           it can be used like this:

             myprog() { echo Using "$@"; cat "$@"; }
             export -f myprog
             parallel --cleanup --header : --tmpl my.tmpl={#}.t myprog {#}.t \
               ::: x 1.234 2.345 3.45678 ::: y 1 2 3

       --tty
           Open  terminal  tty. If GNU parallel is used for starting a program that accesses the tty (such as an
           interactive program) then this option may be needed. It will default to starting only one  job  at  a
           time (i.e. -j1), not buffer the output (i.e. -u), and it will open a tty for the job.

           You can of course override -j1 and -u.

           Using --tty unfortunately means that GNU parallel cannot kill the jobs (with --timeout, --memfree, or
           --halt).  This  is due to GNU parallel giving each child its own process group, which is then killed.
           Process groups are dependant on the tty.

       --tag (alpha testing)
           Tag lines with arguments. Each output line will be prepended with the arguments and  TAB  (\t).  When
           combined with --onall or --nonall the lines will be prepended with the sshlogin instead.

           --tag is ignored when using -u.

           --ctag gives the tag a color.

       --tagstring str (alpha testing)
           Tag  lines  with  a string. Each output line will be prepended with str and TAB (\t). str can contain
           replacement strings such as {}.

           --tagstring is ignored when using -u, --onall, and --nonall.

           --ctagstring gives the tag a color.

       --tee
           Pipe all data to all jobs. Used with --pipe/--pipepart and :::.

             seq 1000 | parallel --pipe --tee -v wc {} ::: -w -l -c

           How many numbers in 1..1000 contain 0..9, and how many bytes do they fill:

             seq 1000 | parallel --pipe --tee --tag \
               'grep {1} | wc {2}' ::: {0..9} ::: -l -c

           How many words contain a..z and how many bytes do they fill?

             parallel -a /usr/share/dict/words --pipepart --tee --tag \
               'grep {1} | wc {2}' ::: {a..z} ::: -l -c

       --termseq sequence
           Termination sequence. When a  job  is  killed  due  to  --timeout,  --memfree,  --halt,  or  abnormal
           termination of GNU parallel, sequence determines how the job is killed. The default is:

               TERM,200,TERM,100,TERM,50,KILL,25

           which  sends a TERM signal, waits 200 ms, sends another TERM signal, waits 100 ms, sends another TERM
           signal, waits 50 ms, sends a KILL signal, waits 25 ms, and exits. GNU parallel detects if  a  process
           dies before the waiting time is up.

       --tmpdir dirname
           Directory  for temporary files. GNU parallel normally buffers output into temporary files in /tmp. By
           setting --tmpdir you can use a different dir for the files. Setting --tmpdir is equivalent to setting
           $TMPDIR.

       --tmux (Long beta testing)
           Use tmux for output. Start a tmux session and run each job in a window  in  that  session.  No  other
           output will be produced.

       --tmuxpane (Long beta testing)
           Use tmux for output but put output into panes in the first window.  Useful if you want to monitor the
           progress of less than 100 concurrent jobs.

       --timeout duration
           Time  out for command. If the command runs for longer than duration seconds it will get killed as per
           --termseq.

           If duration is followed by a % then the timeout will dynamically be computed as a percentage  of  the
           median average runtime of successful jobs. Only values > 100% will make sense.

           duration  is normally in seconds, but can be floats postfixed with s, m, h, or d which would multiply
           the float by 1, 60, 3600, or 86400.  Thus  these  are  equivalent:  --timeout  100000  and  --timeout
           1d3.5h16.6m4s.

       --verbose
       -t  Print the job to be run on stderr (standard error).

           See also: -v, -p.

       --transfer
           Transfer files to remote computers. Shorthand for: --transferfile {}.

       --transferfile filename
       --tf filename
           --transferfile  is  used with --sshlogin to transfer files to the remote computers. The files will be
           transferred using rsync and will be put relative to the work dir (see --workdir).

           The filename will normally contain a replacement string.

           If the path contains /./ the remaining path will be relative  to  the  work  dir  (for  details:  see
           rsync). If the work dir is /home/user, the transferring will be as follows:

             /tmp/foo/bar   => /tmp/foo/bar
             tmp/foo/bar    => /home/user/tmp/foo/bar
             /tmp/./foo/bar => /home/user/foo/bar
             tmp/./foo/bar  => /home/user/foo/bar

           Examples

           This   will   transfer   the  file  foo/bar.txt  to  the  computer  server.example.com  to  the  file
           $HOME/foo/bar.txt before running wc foo/bar.txt on server.example.com:

             echo foo/bar.txt | parallel --transferfile {} \
               --sshlogin server.example.com wc

           This will transfer  the  file  /tmp/foo/bar.txt  to  the  computer  server.example.com  to  the  file
           /tmp/foo/bar.txt before running wc /tmp/foo/bar.txt on server.example.com:

             echo /tmp/foo/bar.txt | parallel --transferfile {} \
               --sshlogin server.example.com wc

           This  will  transfer  the  file  /tmp/foo/bar.txt  to  the  computer  server.example.com  to the file
           foo/bar.txt before running wc ./foo/bar.txt on server.example.com:

             echo /tmp/./foo/bar.txt | parallel --transferfile {} \
               --sshlogin server.example.com wc {= s:.*/\./:./: =}

           --transferfile is often used with --return and  --cleanup.  A  shorthand  for  --transferfile  {}  is
           --transfer.

           --transferfile is ignored when used with --sshlogin : or when not used with --sshlogin.

       --trc filename
           Transfer, Return, Cleanup. Shorthand for:

           --transferfile {} --return filename --cleanup

       --trim <n|l|r|lr|rl>
           Trim white space in input.

           n   No trim. Input is not modified. This is the default.

           l   Left trim. Remove white space from start of input. E.g. " a bc " -> "a bc ".

           r   Right trim. Remove white space from end of input. E.g. " a bc " -> " a bc".

           lr
           rl  Both  trim. Remove white space from both start and end of input. E.g. " a bc " -> "a bc". This is
               the default if --colsep is used.

       --ungroup
       -u  Ungroup output.  Output is printed as soon as possible and bypasses GNU parallel internal processing.
           This may cause output from different commands to be mixed thus should only be used if you do not care
           about the output. Compare these:

             seq 4 | parallel -j0 \
               'sleep {};echo -n start{};sleep {};echo {}end'
             seq 4 | parallel -u -j0 \
               'sleep {};echo -n start{};sleep {};echo {}end'

           It also disables --tag. GNU parallel outputs faster with -u. Compare the speeds of these:

             parallel seq ::: 300000000 >/dev/null
             parallel -u seq ::: 300000000 >/dev/null
             parallel --line-buffer seq ::: 300000000 >/dev/null

           Can be reversed with --group.

           See also: --line-buffer --group

       --extensionreplace replace-str
       --er replace-str
           Use the replacement string replace-str instead of {.} for input line without extension.

       --use-sockets-instead-of-threads
       --use-cores-instead-of-threads
       --use-cpus-instead-of-cores (obsolete)
           Determine how GNU parallel counts the number of CPUs. GNU parallel uses this number when  the  number
           of jobslots is computed relative to the number of CPUs (e.g. 100% or +1).

           CPUs can be counted in three different ways:

           sockets The number of filled CPU sockets (i.e. the number of physical chips).

           cores   The number of physical cores (i.e. the number of physical compute cores).

           threads The  number  of  hyperthreaded  cores  (i.e.  the number of virtual cores - with some of them
                   possibly being hyperthreaded)

           Normally   the   number   of   CPUs   is   computed   as   the   number   of   CPU   threads.    With
           --use-sockets-instead-of-threads or --use-cores-instead-of-threads you can force it to be computed as
           the number of filled sockets or number of cores instead.

           Most users will not need these options.

           --use-cpus-instead-of-cores  is a (misleading) alias for --use-sockets-instead-of-threads and is kept
           for backwards compatibility.

       -v  Verbose.  Print the job to be run on stdout (standard output). Can be  reversed  with  --silent.  See
           also -t.

           Use -v -v to print the wrapping ssh command when running remotely.

       --version
       -V  Print the version GNU parallel and exit.

       --workdir mydir
       --wd mydir
           Jobs  will  be  run  in  the dir mydir. The default is the current dir for the local machine, and the
           login dir for remote computers.

           Files transferred using --transferfile and --return will be relative to mydir on remote computers.

           The special mydir value ... will create working dirs under ~/.parallel/tmp/. If  --cleanup  is  given
           these dirs will be removed.

           The  special  mydir value . uses the current working dir.  If the current working dir is beneath your
           home dir, the value . is treated as the relative path to your home dir. This means that if your  home
           dir  is  different on remote computers (e.g. if your login is different) the relative path will still
           be relative to your home dir.

           To see the difference try:

             parallel -S server pwd ::: ""
             parallel --wd . -S server pwd ::: ""
             parallel --wd ... -S server pwd ::: ""

           mydir can contain GNU parallel's replacement strings.

       --wait
           Wait for all commands to complete.

           Used with --semaphore or --sqlmaster.

           See also: man sem.

       -X  Multiple arguments with context replace. Insert as many arguments as the command line length permits.
           If multiple jobs are being run in parallel: distribute the arguments evenly among the jobs.  Use  -j1
           to avoid this.

           If  {} is not used the arguments will be appended to the line.  If {} is used as part of a word (like
           pic{}.jpg) then the whole word will be repeated. If {}  is  used  multiple  times  each  {}  will  be
           replaced with the arguments.

           Normally  -X will do the right thing, whereas -m can give unexpected results if {} is used as part of
           a word.

           Support for -X with --sshlogin is limited and may fail.

           See also: -m.

       --exit
       -x  Exit if the size (see the -s option) is exceeded.

       --xargs
           Multiple arguments. Insert as many arguments as the command line length permits.

           If {} is not used the arguments will be appended to the line.  If {} is used multiple times  each  {}
           will be replaced with all the arguments.

           Support for --xargs with --sshlogin is limited and may fail.

           See also -X for context replace. If in doubt use -X as that will most likely do what is needed.

EXAMPLES

   EXAMPLE: Working as xargs -n1. Argument appending
       GNU parallel can work similar to xargs -n1.

       To compress all html files using gzip run:

         find . -name '*.html' | parallel gzip --best

       If  the  file  names may contain a newline use -0. Substitute FOO BAR with FUBAR in all files in this dir
       and subdirs:

         find . -type f -print0 | \
           parallel -q0 perl -i -pe 's/FOO BAR/FUBAR/g'

       Note -q is needed because of the space in 'FOO BAR'.

   EXAMPLE: Simple network scanner
       prips can generate IP-addresses from CIDR notation. With GNU parallel you  can  build  a  simple  network
       scanner to see which addresses respond to ping:

         prips 130.229.16.0/20 | \
           parallel --timeout 2 -j0 \
             'ping -c 1 {} >/dev/null && echo {}' 2>/dev/null

   EXAMPLE: Reading arguments from command line
       GNU  parallel can take the arguments from command line instead of stdin (standard input). To compress all
       html files in the current dir using gzip run:

         parallel gzip --best ::: *.html

       To convert *.wav to *.mp3 using LAME running one process per CPU run:

         parallel lame {} -o {.}.mp3 ::: *.wav

   EXAMPLE: Inserting multiple arguments
       When moving a lot of files like this: mv *.log destdir you will sometimes get the error:

         bash: /bin/mv: Argument list too long

       because there are too many files. You can instead do:

         ls | grep -E '\.log$' | parallel mv {} destdir

       This will run mv for each file. It can be done faster if mv gets as many arguments that will fit  on  the
       line:

         ls | grep -E '\.log$' | parallel -m mv {} destdir

       In many shells you can also use printf:

         printf '%s\0' *.log | parallel -0 -m mv {} destdir

   EXAMPLE: Context replace
       To remove the files pict0000.jpg .. pict9999.jpg you could do:

         seq -w 0 9999 | parallel rm pict{}.jpg

       You could also do:

         seq -w 0 9999 | perl -pe 's/(.*)/pict$1.jpg/' | parallel -m rm

       The  first  will  run  rm  10000  times, while the last will only run rm as many times needed to keep the
       command line length short enough to avoid Argument list too long (it typically runs 1-2 times).

       You could also run:

         seq -w 0 9999 | parallel -X rm pict{}.jpg

       This will also only run rm as many times needed to keep the command line length short enough.

   EXAMPLE: Compute intensive jobs and substitution
       If ImageMagick is installed this will generate a thumbnail of a jpg file:

         convert -geometry 120 foo.jpg thumb_foo.jpg

       This will run with number-of-cpus jobs in parallel for all jpg files in a directory:

         ls *.jpg | parallel convert -geometry 120 {} thumb_{}

       To do it recursively use find:

         find . -name '*.jpg' | \
           parallel convert -geometry 120 {} {}_thumb.jpg

       Notice how the argument has to start with {} as {} will include path (e.g. running convert -geometry  120
       ./foo/bar.jpg  thumb_./foo/bar.jpg  would  clearly  be  wrong).  The  command  will  generate  files like
       ./foo/bar.jpg_thumb.jpg.

       Use {.} to avoid the extra .jpg in the file name. This command will make files like ./foo/bar_thumb.jpg:

         find . -name '*.jpg' | \
           parallel convert -geometry 120 {} {.}_thumb.jpg

   EXAMPLE: Substitution and redirection
       This will generate an uncompressed version of .gz-files next to the .gz-file:

         parallel zcat {} ">"{.} ::: *.gz

       Quoting of > is necessary to postpone the redirection. Another solution is to quote the whole command:

         parallel "zcat {} >{.}" ::: *.gz

       Other special shell characters (such as * ; $ > < |  >> <<) also need to be put in quotes,  as  they  may
       otherwise be interpreted by the shell and not given to GNU parallel.

   EXAMPLE: Composed commands
       A job can consist of several commands. This will print the number of files in each directory:

         ls | parallel 'echo -n {}" "; ls {}|wc -l'

       To put the output in a file called <name>.dir:

         ls | parallel '(echo -n {}" "; ls {}|wc -l) >{}.dir'

       Even small shell scripts can be run by GNU parallel:

         find . | parallel 'a={}; name=${a##*/};' \
           'upper=$(echo "$name" | tr "[:lower:]" "[:upper:]");'\
           'echo "$name - $upper"'

         ls | parallel 'mv {} "$(echo {} | tr "[:upper:]" "[:lower:]")"'

       Given a list of URLs, list all URLs that fail to download. Print the line number and the URL.

         cat urlfile | parallel "wget {} 2>/dev/null || grep -n {} urlfile"

       Create a mirror directory with the same filenames except all files and symlinks are empty files.

         cp -rs /the/source/dir mirror_dir
         find mirror_dir -type l | parallel -m rm {} '&&' touch {}

       Find the files in a list that do not exist

         cat file_list | parallel 'if [ ! -e {} ] ; then echo {}; fi'

   EXAMPLE: Composed command with perl replacement string
       You  have a bunch of file. You want them sorted into dirs. The dir of each file should be named the first
       letter of the file name.

         parallel 'mkdir -p {=s/(.).*/$1/=}; mv {} {=s/(.).*/$1/=}' ::: *

   EXAMPLE: Composed command with multiple input sources
       You have a dir with files named as 24 hours in 5 minute intervals: 00:00, 00:05, 00:10 .. 23:55. You want
       to find the files missing:

         parallel [ -f {1}:{2} ] "||" echo {1}:{2} does not exist \
           ::: {00..23} ::: {00..55..5}

   EXAMPLE: Calling Bash functions
       If the composed command is longer than a line, it becomes hard to read. In Bash you  can  use  functions.
       Just remember to export -f the function.

         doit() {
           echo Doing it for $1
           sleep 2
           echo Done with $1
         }
         export -f doit
         parallel doit ::: 1 2 3

         doubleit() {
           echo Doing it for $1 $2
           sleep 2
           echo Done with $1 $2
         }
         export -f doubleit
         parallel doubleit ::: 1 2 3 ::: a b

       To do this on remote servers you need to transfer the function using --env:

         parallel --env doit -S server doit ::: 1 2 3
         parallel --env doubleit -S server doubleit ::: 1 2 3 ::: a b

       If  your  environment  (aliases,  variables,  and  functions)  is small you can copy the full environment
       without having to export -f anything. See env_parallel.

   EXAMPLE: Function tester
       To test a program with different parameters:

         tester() {
           if (eval "$@") >&/dev/null; then
             perl -e 'printf "\033[30;102m[ OK ]\033[0m @ARGV\n"' "$@"
           else
             perl -e 'printf "\033[30;101m[FAIL]\033[0m @ARGV\n"' "$@"
           fi
         }
         export -f tester
         parallel tester my_program ::: arg1 arg2
         parallel tester exit ::: 1 0 2 0

       If my_program fails a red FAIL will be printed followed by the failing command; otherwise a green OK will
       be printed followed by the command.

   EXAMPLE: Continously show the latest line of output
       It can be useful to monitor the output of running jobs.

       This shows the most recent output line until a job finishes. After which the output of the job is printed
       in full:

         parallel '{} | tee >(cat >&3)' ::: 'command 1' 'command 2' \
           3> >(perl -ne '$|=1;chomp;printf"%.'$COLUMNS's\r",$_." "x100')

   EXAMPLE: Log rotate
       Log rotation renames a logfile to an extension with a higher number: log.1 becomes log.2,  log.2  becomes
       log.3, and so on. The oldest log is removed. To avoid overwriting files the process starts backwards from
       the high number to the low number.  This will keep 10 old versions of the log:

         seq 9 -1 1 | parallel -j1 mv log.{} log.'{= $_++ =}'
         mv log log.1

   EXAMPLE: Removing file extension when processing files
       When processing files removing the file extension using {.} is often useful.

       Create a directory for each zip-file and unzip it in that dir:

         parallel 'mkdir {.}; cd {.}; unzip ../{}' ::: *.zip

       Recompress all .gz files in current directory using bzip2 running 1 job per CPU in parallel:

         parallel "zcat {} | bzip2 >{.}.bz2 && rm {}" ::: *.gz

       Convert all WAV files to MP3 using LAME:

         find sounddir -type f -name '*.wav' | parallel lame {} -o {.}.mp3

       Put all converted in the same directory:

         find sounddir -type f -name '*.wav' | \
           parallel lame {} -o mydir/{/.}.mp3

   EXAMPLE: Removing strings from the argument
       If you have directory with tar.gz files and want these extracted in the corresponding dir (e.g foo.tar.gz
       will be extracted in the dir foo) you can do:

         parallel --plus 'mkdir {..}; tar -C {..} -xf {}' ::: *.tar.gz

       If you want to remove a different ending, you can use {%string}:

         parallel --plus echo {%_demo} ::: mycode_demo keep_demo_here

       You can also remove a starting string with {#string}

         parallel --plus echo {#demo_} ::: demo_mycode keep_demo_here

       To  remove  a  string  anywhere  you can use regular expressions with {/regexp/replacement} and leave the
       replacement empty:

         parallel --plus echo {/demo_/} ::: demo_mycode remove_demo_here

   EXAMPLE: Download 24 images for each of the past 30 days
       Let us assume a website stores images like:

         https://www.example.com/path/to/YYYYMMDD_##.jpg

       where YYYYMMDD is the date and ## is the number 01-24. This will download images for the past 30 days:

         getit() {
           date=$(date -d "today -$1 days" +%Y%m%d)
           num=$2
           echo wget https://www.example.com/path/to/${date}_${num}.jpg
         }
         export -f getit

         parallel getit ::: $(seq 30) ::: $(seq -w 24)

       $(date -d "today -$1 days" +%Y%m%d) will give the dates in YYYYMMDD with $1 days subtracted.

   EXAMPLE: Download world map from NASA
       NASA provides tiles to download on earthdata.nasa.gov. Download tiles  for  Blue  Marble  world  map  and
       create a 10240x20480 map.

         base=https://map1a.vis.earthdata.nasa.gov/wmts-geo/wmts.cgi
         service="SERVICE=WMTS&REQUEST=GetTile&VERSION=1.0.0"
         layer="LAYER=BlueMarble_ShadedRelief_Bathymetry"
         set="STYLE=&TILEMATRIXSET=EPSG4326_500m&TILEMATRIX=5"
         tile="TILEROW={1}&TILECOL={2}"
         format="FORMAT=image%2Fjpeg"
         url="$base?$service&$layer&$set&$tile&$format"

         parallel -j0 -q wget "$url" -O {1}_{2}.jpg ::: {0..19} ::: {0..39}
         parallel eval convert +append {}_{0..39}.jpg line{}.jpg ::: {0..19}
         convert -append line{0..19}.jpg world.jpg

   EXAMPLE: Download Apollo-11 images from NASA using jq
       Search  NASA  using their API to get JSON for images related to 'apollo 11' and has 'moon landing' in the
       description.

       The search query returns JSON containing URLs to JSON containing collections  of  pictures.  One  of  the
       pictures in each of these collection is large.

       wget  is  used  to  get  the  JSON  for  the  search  query.  jq  is then used to extract the URLs of the
       collections. parallel then calls wget to get each collection, which is passed to jq to extract  the  URLs
       of all images. grep filters out the large images, and parallel finally uses wget to fetch the images.

         base="https://images-api.nasa.gov/search"
         q="q=apollo 11"
         description="description=moon landing"
         media_type="media_type=image"
         wget -O - "$base?$q&$description&$media_type" |
           jq -r .collection.items[].href |
           parallel wget -O - |
           jq -r .[] |
           grep large |
           parallel wget

   EXAMPLE: Download video playlist in parallel
       youtube-dl  is  an  excellent  tool to download videos. It can, however, not download videos in parallel.
       This takes a playlist and downloads 10 videos in parallel.

         url='youtu.be/watch?v=0wOf2Fgi3DE&list=UU_cznB5YZZmvAmeq7Y3EriQ'
         export url
         youtube-dl --flat-playlist "https://$url" |
           parallel --tagstring {#} --lb -j10 \
             youtube-dl --playlist-start {#} --playlist-end {#} '"https://$url"'

   EXAMPLE: Prepend last modified date (ISO8601) to file name
         parallel mv {} '{= $a=pQ($_); $b=$_;' \
           '$_=qx{date -r "$a" +%FT%T}; chomp; $_="$_ $b" =}' ::: *

       {= and =} mark a perl expression. pQ perl-quotes the string. date +%FT%T is  the  date  in  ISO8601  with
       time.

   EXAMPLE: Save output in ISO8601 dirs
       Save output from ps aux every second into dirs named yyyy-mm-ddThh:mm:ss+zz:zz.

         seq 1000 | parallel -N0 -j1 --delay 1 \
           --results '{= $_=`date -Isec`; chomp=}/' ps aux

   EXAMPLE: Digital clock with "blinking" :
       The : in a digital clock blinks. To make every other line have a ':' and the rest a ' ' a perl expression
       is used to look at the 3rd input source. If the value modulo 2 is 1: Use ":" otherwise use " ":

         parallel -k echo {1}'{=3 $_=$_%2?":":" "=}'{2}{3} \
           ::: {0..12} ::: {0..5} ::: {0..9}

   EXAMPLE: Aggregating content of files
       This:

         parallel --header : echo x{X}y{Y}z{Z} \> x{X}y{Y}z{Z} \
         ::: X {1..5} ::: Y {01..10} ::: Z {1..5}

       will  generate  the files x1y01z1 .. x5y10z5. If you want to aggregate the output grouping on x and z you
       can do this:

         parallel eval 'cat {=s/y01/y*/=} > {=s/y01//=}' ::: *y01*

       For all values of x and z it runs commands like:

         cat x1y*z1 > x1z1

       So you end up with x1z1 .. x5z5 each containing the content of all values of y.

   EXAMPLE: Breadth first parallel web crawler/mirrorer
       This script below will crawl and mirror a URL in parallel.  It downloads first pages  that  are  1  click
       down,  then  2  clicks down, then 3; instead of the normal depth first, where the first link link on each
       page is fetched first.

       Run like this:

         PARALLEL=-j100 ./parallel-crawl http://gatt.org.yeslab.org/

       Remove the wget part if you only want a web crawler.

       It works by fetching a page from a list of URLs and looking for links in that page that  are  within  the
       same starting URL and that have not already been seen. These links are added to a new queue. When all the
       pages  from  the list is done, the new queue is moved to the list of URLs and the process is started over
       until no unseen links are found.

         #!/bin/bash

         # E.g. http://gatt.org.yeslab.org/
         URL=$1
         # Stay inside the start dir
         BASEURL=$(echo $URL | perl -pe 's:#.*::; s:(//.*/)[^/]*:$1:')
         URLLIST=$(mktemp urllist.XXXX)
         URLLIST2=$(mktemp urllist.XXXX)
         SEEN=$(mktemp seen.XXXX)

         # Spider to get the URLs
         echo $URL >$URLLIST
         cp $URLLIST $SEEN

         while [ -s $URLLIST ] ; do
           cat $URLLIST |
             parallel lynx -listonly -image_links -dump {} \; \
               wget -qm -l1 -Q1 {} \; echo Spidered: {} \>\&2 |
               perl -ne 's/#.*//; s/\s+\d+.\s(\S+)$/$1/ and
                 do { $seen{$1}++ or print }' |
             grep -F $BASEURL |
             grep -v -x -F -f $SEEN | tee -a $SEEN > $URLLIST2
           mv $URLLIST2 $URLLIST
         done

         rm -f $URLLIST $URLLIST2 $SEEN

   EXAMPLE: Process files from a tar file while unpacking
       If the files to be processed are in a tar file then unpacking one file and processing it immediately  may
       be faster than first unpacking all files.

         tar xvf foo.tgz | perl -ne 'print $l;$l=$_;END{print $l}' | \
           parallel echo

       The Perl one-liner is needed to make sure the file is complete before handing it to GNU parallel.

   EXAMPLE: Rewriting a for-loop and a while-read-loop
       for-loops like this:

         (for x in `cat list` ; do
           do_something $x
         done) | process_output

       and while-read-loops like this:

         cat list | (while read x ; do
           do_something $x
         done) | process_output

       can be written like this:

         cat list | parallel do_something | process_output

       For example: Find which host name in a list has IP address 1.2.3 4:

         cat hosts.txt | parallel -P 100 host | grep 1.2.3.4

       If the processing requires more steps the for-loop like this:

         (for x in `cat list` ; do
           no_extension=${x%.*};
           do_step1 $x scale $no_extension.jpg
           do_step2 <$x $no_extension
         done) | process_output

       and while-loops like this:

         cat list | (while read x ; do
           no_extension=${x%.*};
           do_step1 $x scale $no_extension.jpg
           do_step2 <$x $no_extension
         done) | process_output

       can be written like this:

         cat list | parallel "do_step1 {} scale {.}.jpg ; do_step2 <{} {.}" |\
           process_output

       If the body of the loop is bigger, it improves readability to use a function:

         (for x in `cat list` ; do
           do_something $x
           [... 100 lines that do something with $x ...]
         done) | process_output

         cat list | (while read x ; do
           do_something $x
           [... 100 lines that do something with $x ...]
         done) | process_output

       can both be rewritten as:

         doit() {
           x=$1
           do_something $x
           [... 100 lines that do something with $x ...]
         }
         export -f doit
         cat list | parallel doit

   EXAMPLE: Rewriting nested for-loops
       Nested for-loops like this:

         (for x in `cat xlist` ; do
           for y in `cat ylist` ; do
             do_something $x $y
           done
         done) | process_output

       can be written like this:

         parallel do_something {1} {2} :::: xlist ylist | process_output

       Nested for-loops like this:

         (for colour in red green blue ; do
           for size in S M L XL XXL ; do
             echo $colour $size
           done
         done) | sort

       can be written like this:

         parallel echo {1} {2} ::: red green blue ::: S M L XL XXL | sort

   EXAMPLE: Finding the lowest difference between files
       diff  is  good for finding differences in text files. diff | wc -l gives an indication of the size of the
       difference. To find the differences between all files in the current dir do:

         parallel --tag 'diff {1} {2} | wc -l' ::: * ::: * | sort -nk3

       This way it is possible to see if some files are closer to other files.

   EXAMPLE: for-loops with column names
       When doing multiple nested for-loops it can be easier to keep track of the loop variable if is  is  named
       instead  of  just  having  a  number.  Use --header : to let the first argument be an named alias for the
       positional replacement string:

         parallel --header : echo {colour} {size} \
           ::: colour red green blue ::: size S M L XL XXL

       This also works if the input file is a file with columns:

         cat addressbook.tsv | \
           parallel --colsep '\t' --header : echo {Name} {E-mail address}

   EXAMPLE: All combinations in a list
       GNU parallel makes all combinations when given two lists.

       To make all combinations in a single list with unique values, you repeat the  list  and  use  replacement
       string {choose_k}:

         parallel --plus echo {choose_k} ::: A B C D ::: A B C D

         parallel --plus echo 2{2choose_k} 1{1choose_k} ::: A B C D ::: A B C D

       {choose_k} works for any number of input sources:

         parallel --plus echo {choose_k} ::: A B C D ::: A B C D ::: A B C D

   EXAMPLE: From a to b and b to c
       Assume you have input like:

         aardvark
         babble
         cab
         dab
         each

       and want to run combinations like:

         aardvark babble
         babble cab
         cab dab
         dab each

       If the input is in the file in.txt:

         parallel echo {1} - {2} ::::+ <(head -n -1 in.txt) <(tail -n +2 in.txt)

       If the input is in the array $a here are two solutions:

         seq $((${#a[@]}-1)) | \
           env_parallel --env a echo '${a[{=$_--=}]} - ${a[{}]}'
         parallel echo {1} - {2} ::: "${a[@]::${#a[@]}-1}" :::+ "${a[@]:1}"

   EXAMPLE: Count the differences between all files in a dir
       Using --results the results are saved in /tmp/diffcount*.

         parallel --results /tmp/diffcount "diff -U 0 {1} {2} | \
           tail -n +3 |grep -v '^@'|wc -l" ::: * ::: *

       To see the difference between file A and file B look at the file '/tmp/diffcount/1/A/2/B'.

   EXAMPLE: Speeding up fast jobs
       Starting  a job on the local machine takes around 10 ms. This can be a big overhead if the job takes very
       few ms to run. Often you can group small jobs together  using  -X  which  will  make  the  overhead  less
       significant. Compare the speed of these:

         seq -w 0 9999 | parallel touch pict{}.jpg
         seq -w 0 9999 | parallel -X touch pict{}.jpg

       If  your  program  cannot  take  multiple  arguments, then you can use GNU parallel to spawn multiple GNU
       parallels:

         seq -w 0 9999999 | \
           parallel -j10 -q -I,, --pipe parallel -j0 touch pict{}.jpg

       If -j0 normally spawns 252 jobs, then the above will try to spawn 2520 jobs. On a normal GNU/Linux system
       you can spawn 32000 jobs using this technique with no problems. To  raise  the  32000  jobs  limit  raise
       /proc/sys/kernel/pid_max to 4194303.

       If  you  do  not need GNU parallel to have control over each job (so no need for --retries or --joblog or
       similar), then it can be even faster if you can generate the command lines and pipe those to a shell.  So
       if you can do this:

         mygenerator | sh

       Then that can be parallelized like this:

         mygenerator | parallel --pipe --block 10M sh

       E.g.

         mygenerator() {
           seq 10000000 | perl -pe 'print "echo This is fast job number "';
         }
         mygenerator | parallel --pipe --block 10M sh

       The overhead is 100000 times smaller namely around 100 nanoseconds per job.

   EXAMPLE: Using shell variables
       When  using  shell variables you need to quote them correctly as they may otherwise be interpreted by the
       shell.

       Notice the difference between:

         ARR=("My brother's 12\" records are worth <\$\$\$>"'!' Foo Bar)
         parallel echo ::: ${ARR[@]} # This is probably not what you want

       and:

         ARR=("My brother's 12\" records are worth <\$\$\$>"'!' Foo Bar)
         parallel echo ::: "${ARR[@]}"

       When using variables in the actual command that contains special characters (e.g. space)  you  can  quote
       them using '"$VAR"' or using "'s and -q:

         VAR="My brother's 12\" records are worth <\$\$\$>"
         parallel -q echo "$VAR" ::: '!'
         export VAR
         parallel echo '"$VAR"' ::: '!'

       If $VAR does not contain ' then "'$VAR'" will also work (and does not need export):

         VAR="My 12\" records are worth <\$\$\$>"
         parallel echo "'$VAR'" ::: '!'

       If you use them in a function you just quote as you normally would do:

         VAR="My brother's 12\" records are worth <\$\$\$>"
         export VAR
         myfunc() { echo "$VAR" "$1"; }
         export -f myfunc
         parallel myfunc ::: '!'

   EXAMPLE: Group output lines
       When  running  jobs  that output data, you often do not want the output of multiple jobs to run together.
       GNU parallel defaults to grouping the output of each job, so the output is printed when the job finishes.
       If you want full lines to be printed while the job is running you can  use  --line-buffer.  If  you  want
       output to be printed as soon as possible you can use -u.

       Compare the output of:

         parallel wget --limit-rate=100k \
           https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
           ::: {12..16}
         parallel --line-buffer wget --limit-rate=100k \
           https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
           ::: {12..16}
         parallel -u wget --limit-rate=100k \
           https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
           ::: {12..16}

   EXAMPLE: Tag output lines
       GNU  parallel  groups  the  output lines, but it can be hard to see where the different jobs begin. --tag
       prepends the argument to make that more visible:

         parallel --tag wget --limit-rate=100k \
           https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
           ::: {12..16}

       --tag works with --line-buffer but not with -u:

         parallel --tag --line-buffer wget --limit-rate=100k \
           https://ftpmirror.gnu.org/parallel/parallel-20{}0822.tar.bz2 \
           ::: {12..16}

       Check the uptime of the servers in ~/.parallel/sshloginfile:

         parallel --tag -S .. --nonall uptime

   EXAMPLE: Colorize output
       Give each job a new color. Most terminals support ANSI colors with the escape code "\033[30;3Xm" where  0
       <= X <= 7:

           seq 10 | \
             parallel --tagstring '\033[30;3{=$_=++$::color%8=}m' seq {}
           parallel --rpl '{color} $_="\033[30;3".(++$::color%8)."m"' \
             --tagstring {color} seq {} ::: {1..10}

       To get rid of the initial \t (which comes from --tagstring):

           ... | perl -pe 's/\t//'

   EXAMPLE: Keep order of output same as order of input
       Normally the output of a job will be printed as soon as it completes. Sometimes you want the order of the
       output  to  remain  the same as the order of the input. This is often important, if the output is used as
       input for another system. -k will make sure the order of output will be in the same order as  input  even
       if later jobs end before earlier jobs.

       Append a string to every line in a text file:

         cat textfile | parallel -k echo {} append_string

       If you remove -k some of the lines may come out in the wrong order.

       Another example is traceroute:

         parallel traceroute ::: qubes-os.org debian.org freenetproject.org

       will  give traceroute of qubes-os.org, debian.org and freenetproject.org, but it will be sorted according
       to which job completed first.

       To keep the order the same as input run:

         parallel -k traceroute ::: qubes-os.org debian.org freenetproject.org

       This will make sure the traceroute to qubes-os.org will be printed first.

       A bit more complex example is downloading a huge file in chunks in parallel:  Some  internet  connections
       will  deliver  more  data  if  you  download  files  in  parallel. For downloading files in parallel see:
       "EXAMPLE: Download 10 images for each of the past 30 days". But if you are downloading a big file you can
       download the file in chunks in parallel.

       To download byte 10000000-19999999 you can use curl:

         curl -r 10000000-19999999 https://example.com/the/big/file >file.part

       To download a 1 GB file we need 100 10MB chunks downloaded and combined in the correct order.

         seq 0 99 | parallel -k curl -r \
           {}0000000-{}9999999 https://example.com/the/big/file > file

   EXAMPLE: Parallel grep
       grep -r greps recursively through directories. On multicore CPUs GNU parallel can often speed this up.

         find . -type f | parallel -k -j150% -n 1000 -m grep -H -n STRING {}

       This will run 1.5 job per CPU, and give 1000 arguments to grep.

   EXAMPLE: Grepping n lines for m regular expressions.
       The simplest solution to grep a big file for a lot of regexps is:

         grep -f regexps.txt bigfile

       Or if the regexps are fixed strings:

         grep -F -f regexps.txt bigfile

       There are 3 limiting factors: CPU, RAM, and disk I/O.

       RAM is easy to measure: If the grep process takes up most of your free memory (e.g.  when  running  top),
       then RAM is a limiting factor.

       CPU  is  also  easy to measure: If the grep takes >90% CPU in top, then the CPU is a limiting factor, and
       parallelization will speed this up.

       It is harder to see if disk I/O is the limiting factor, and depending on the disk system it may be faster
       or slower to parallelize. The only way to know for certain is to test and measure.

       Limiting factor: RAM

       The normal grep -f regexps.txt bigfile works no matter the size of bigfile, but if regexps.txt is so  big
       it cannot fit into memory, then you need to split this.

       grep  -F  takes around 100 bytes of RAM and grep takes about 500 bytes of RAM per 1 byte of regexp. So if
       regexps.txt is 1% of your RAM, then it may be too big.

       If you can convert your regexps into fixed strings do that. E.g. if the lines  you  are  looking  for  in
       bigfile all looks like:

         ID1 foo bar baz Identifier1 quux
         fubar ID2 foo bar baz Identifier2

       then your regexps.txt can be converted from:

         ID1.*Identifier1
         ID2.*Identifier2

       into:

         ID1 foo bar baz Identifier1
         ID2 foo bar baz Identifier2

       This way you can use grep -F which takes around 80% less memory and is much faster.

       If it still does not fit in memory you can do this:

         parallel --pipepart -a regexps.txt --block 1M grep -F -f - -n bigfile | \
           sort -un | perl -pe 's/^\d+://'

       The 1M should be your free memory divided by the number of CPU threads and divided by 200 for grep -F and
       by 1000 for normal grep. On GNU/Linux you can do:

         free=$(awk '/^((Swap)?Cached|MemFree|Buffers):/ { sum += $2 }
                     END { print sum }' /proc/meminfo)
         percpu=$((free / 200 / $(parallel --number-of-threads)))k

         parallel --pipepart -a regexps.txt --block $percpu --compress \
           grep -F -f - -n bigfile | \
           sort -un | perl -pe 's/^\d+://'

       If you can live with duplicated lines and wrong order, it is faster to do:

         parallel --pipepart -a regexps.txt --block $percpu --compress \
           grep -F -f - bigfile

       Limiting factor: CPU

       If the CPU is the limiting factor parallelization should be done on the regexps:

         cat regexps.txt | parallel --pipe -L1000 --roundrobin --compress \
           grep -f - -n bigfile | \
           sort -un | perl -pe 's/^\d+://'

       The  command  will  start  one  grep  per  CPU  and read bigfile one time per CPU, but as that is done in
       parallel, all reads except the first will be cached in RAM. Depending on the size of regexps.txt  it  may
       be faster to use --block 10m instead of -L1000.

       Some  storage systems perform better when reading multiple chunks in parallel. This is true for some RAID
       systems and for some network file systems. To parallelize the reading of bigfile:

         parallel --pipepart --block 100M -a bigfile -k --compress \
           grep -f regexps.txt

       This will split bigfile into 100MB chunks and run grep on each  of  these  chunks.  To  parallelize  both
       reading of bigfile and regexps.txt combine the two using --cat:

         parallel --pipepart --block 100M -a bigfile --cat cat regexps.txt \
           \| parallel --pipe -L1000 --roundrobin grep -f - {}

       If a line matches multiple regexps, the line may be duplicated.

       Bigger problem

       If the problem is too big to be solved by this, you are probably ready for Lucene.

   EXAMPLE: Using remote computers
       To  run  commands  on  a  remote  computer  SSH  needs to be set up and you must be able to login without
       entering a password (The commands ssh-copy-id, ssh-agent, and sshpass may help you do that).

       If you need to login to a whole cluster, you typically do not want to accept the host key for every host.
       You want to accept them the first time and be warned if they are ever changed. To do that:

         # Add the servers to the sshloginfile
         (echo servera; echo serverb) > .parallel/my_cluster
         # Make sure .ssh/config exist
         touch .ssh/config
         cp .ssh/config .ssh/config.backup
         # Disable StrictHostKeyChecking temporarily
         (echo 'Host *'; echo StrictHostKeyChecking no) >> .ssh/config
         parallel --slf my_cluster --nonall true
         # Remove the disabling of StrictHostKeyChecking
         mv .ssh/config.backup .ssh/config

       The servers in .parallel/my_cluster are now added in .ssh/known_hosts.

       To run echo on server.example.com:

         seq 10 | parallel --sshlogin server.example.com echo

       To run commands on more than one remote computer run:

         seq 10 | parallel --sshlogin s1.example.com,s2.example.net echo

       Or:

         seq 10 | parallel --sshlogin server.example.com \
           --sshlogin server2.example.net echo

       If the login username is foo on server2.example.net use:

         seq 10 | parallel --sshlogin server.example.com \
           --sshlogin foo@server2.example.net echo

       If your list of hosts is server1-88.example.net with login foo:

         seq 10 | parallel -Sfoo@server{1..88}.example.net echo

       To distribute the commands to a list of computers, make a file mycomputers with all the computers:

         server.example.com
         foo@server2.example.com
         server3.example.com

       Then run:

         seq 10 | parallel --sshloginfile mycomputers echo

       To include the local computer add the special sshlogin ':' to the list:

         server.example.com
         foo@server2.example.com
         server3.example.com
         :

       GNU parallel will try to determine the number of CPUs on each of the remote computers, and  run  one  job
       per CPU - even if the remote computers do not have the same number of CPUs.

       If the number of CPUs on the remote computers is not identified correctly the number of CPUs can be added
       in front. Here the computer has 8 CPUs.

         seq 10 | parallel --sshlogin 8/server.example.com echo

   EXAMPLE: Transferring of files
       To recompress gzipped files with bzip2 using a remote computer run:

         find logs/ -name '*.gz' | \
           parallel --sshlogin server.example.com \
           --transfer "zcat {} | bzip2 -9 >{.}.bz2"

       This  will  list the .gz-files in the logs directory and all directories below. Then it will transfer the
       files to server.example.com to the corresponding directory in $HOME/logs. On server.example.com the  file
       will  be  recompressed  using  zcat  and bzip2 resulting in the corresponding file with .gz replaced with
       .bz2.

       If you want the resulting bz2-file to be transferred back to the local computer add --return {.}.bz2:

         find logs/ -name '*.gz' | \
           parallel --sshlogin server.example.com \
           --transfer --return {.}.bz2 "zcat {} | bzip2 -9 >{.}.bz2"

       After the recompressing is done the .bz2-file is transferred back to the local computer and put  next  to
       the original .gz-file.

       If  you  want to delete the transferred files on the remote computer add --cleanup. This will remove both
       the file transferred to the remote computer and the files transferred from the remote computer:

         find logs/ -name '*.gz' | \
           parallel --sshlogin server.example.com \
           --transfer --return {.}.bz2 --cleanup "zcat {} | bzip2 -9 >{.}.bz2"

       If you want run on several computers add the  computers  to  --sshlogin  either  using  ','  or  multiple
       --sshlogin:

         find logs/ -name '*.gz' | \
           parallel --sshlogin server.example.com,server2.example.com \
           --sshlogin server3.example.com \
           --transfer --return {.}.bz2 --cleanup "zcat {} | bzip2 -9 >{.}.bz2"

       You  can  add  the local computer using --sshlogin :. This will disable the removing and transferring for
       the local computer only:

         find logs/ -name '*.gz' | \
           parallel --sshlogin server.example.com,server2.example.com \
           --sshlogin server3.example.com \
           --sshlogin : \
           --transfer --return {.}.bz2 --cleanup "zcat {} | bzip2 -9 >{.}.bz2"

       Often --transfer, --return and --cleanup are used together. They can be shortened to --trc:

         find logs/ -name '*.gz' | \
           parallel --sshlogin server.example.com,server2.example.com \
           --sshlogin server3.example.com \
           --sshlogin : \
           --trc {.}.bz2 "zcat {} | bzip2 -9 >{.}.bz2"

       With the file mycomputers containing the list of computers it becomes:

         find logs/ -name '*.gz' | parallel --sshloginfile mycomputers \
           --trc {.}.bz2 "zcat {} | bzip2 -9 >{.}.bz2"

       If the file ~/.parallel/sshloginfile contains the list of computers the special short hand -S ..  can  be
       used:

         find logs/ -name '*.gz' | parallel -S .. \
           --trc {.}.bz2 "zcat {} | bzip2 -9 >{.}.bz2"

   EXAMPLE: Advanced file transfer
       Assume you have files in in/*, want them processed on server, and transferred back into /other/dir:

         parallel -S server --trc /other/dir/./{/}.out \
           cp {/} {/}.out ::: in/./*

   EXAMPLE: Distributing work to local and remote computers
       Convert *.mp3 to *.ogg running one process per CPU on local computer and server2:

         parallel --trc {.}.ogg -S server2,: \
           'mpg321 -w - {} | oggenc -q0 - -o {.}.ogg' ::: *.mp3

   EXAMPLE: Running the same command on remote computers
       To run the command uptime on remote computers you can do:

         parallel --tag --nonall -S server1,server2 uptime

       --nonall reads no arguments. If you have a list of jobs you want to run on each computer you can do:

         parallel --tag --onall -S server1,server2 echo ::: 1 2 3

       Remove --tag if you do not want the sshlogin added before the output.

       If you have a lot of hosts use '-j0' to access more hosts in parallel.

   EXAMPLE: Running 'sudo' on remote computers
       Put the password into passwordfile then run:

         parallel --ssh 'cat passwordfile | ssh' --nonall \
           -S user@server1,user@server2 sudo -S ls -l /root

   EXAMPLE: Using remote computers behind NAT wall
       If the workers are behind a NAT wall, you need some trickery to get to them.

       If  you can ssh to a jumphost, and reach the workers from there, then the obvious solution would be this,
       but it does not work:

         parallel --ssh 'ssh jumphost ssh' -S host1 echo ::: DOES NOT WORK

       It does not work because the command is dequoted by ssh twice where as GNU parallel only expects it to be
       dequoted once.

       You can use a bash function and have GNU parallel quote the command:

         jumpssh() { ssh -A jumphost ssh $(parallel --shellquote ::: "$@"); }
         export -f jumpssh
         parallel --ssh jumpssh -S host1 echo ::: this works

       Or you can instead put this in ~/.ssh/config:

         Host host1 host2 host3
           ProxyCommand ssh jumphost.domain nc -w 1 %h 22

       It requires nc(netcat) to be installed on jumphost. With this you can simply:

         parallel -S host1,host2,host3 echo ::: This does work

       No jumphost, but port forwards

       If there is no jumphost but each server has port 22 forwarded from the firewall (e.g. the firewall's port
       22001 = port 22 on host1, 22002 = host2, 22003 = host3) then you can use ~/.ssh/config:

         Host host1.v
           Port 22001
         Host host2.v
           Port 22002
         Host host3.v
           Port 22003
         Host *.v
           Hostname firewall

       And then use host{1..3}.v as normal hosts:

         parallel -S host1.v,host2.v,host3.v echo ::: a b c

       No jumphost, no port forwards

       If ports cannot be forwarded, you need some sort of VPN to traverse the NAT-wall. TOR is one options  for
       that, as it is very easy to get working.

       You need to install TOR and setup a hidden service. In torrc put:

         HiddenServiceDir /var/lib/tor/hidden_service/
         HiddenServicePort 22 127.0.0.1:22

       Then start TOR: /etc/init.d/tor restart

       The   TOR   hostname   is  now  in  /var/lib/tor/hidden_service/hostname  and  is  something  similar  to
       izjafdceobowklhz.onion. Now you simply prepend torsocks to ssh:

         parallel --ssh 'torsocks ssh' -S izjafdceobowklhz.onion \
           -S zfcdaeiojoklbwhz.onion,auclucjzobowklhi.onion echo ::: a b c

       If not all hosts are accessible through TOR:

         parallel -S 'torsocks ssh izjafdceobowklhz.onion,host2,host3' \
           echo ::: a b c

       See more ssh tricks on https://en.wikibooks.org/wiki/OpenSSH/Cookbook/Proxies_and_Jump_Hosts

   EXAMPLE: Use outrun instead of ssh
       outrun lets you run a command on a remote server. outrun sets up a connection  to  access  files  at  the
       source server, and automatically transfers files. outrun must be installed on the remote system.

       You can use outrun in an sshlogin this way:

         parallel -S 'outrun user@server eval' command

   EXAMPLE: Slurm cluster
       The Slurm Workload Manager is used in many clusters.

       Here is a simple example of using GNU parallel to call srun:

         #!/bin/bash

         #SBATCH --time 00:02:00
         #SBATCH --ntasks=4
         #SBATCH --job-name GnuParallelDemo
         #SBATCH --output gnuparallel.out

         module purge
         module load gnu_parallel

         my_parallel="parallel --delay .2 -j $SLURM_NTASKS"
         my_srun="srun --export=all --exclusive -n1 --cpus-per-task=1 --cpu-bind=cores"
         $my_parallel "$my_srun" echo This is job {} ::: {1..20}

   EXAMPLE: Parallelizing rsync
       rsync  is a great tool, but sometimes it will not fill up the available bandwidth. Running multiple rsync
       in parallel can fix this.

         cd src-dir
         find . -type f |
           parallel -j10 -X rsync -zR -Ha ./{} fooserver:/dest-dir/

       Adjust -j10 until you find the optimal number.

       rsync -R will create the needed subdirectories, so all files are not put into a single  dir.  The  ./  is
       needed so the resulting command looks similar to:

         rsync -zR ././sub/dir/file fooserver:/dest-dir/

       The /./ is what rsync -R works on.

       If  you  are  unable  to  push  data,  but  need  to  pull them and the files are called digits.png (e.g.
       000000.png) you might be able to do:

         seq -w 0 99 | parallel rsync -Havessh fooserver:src/*{}.png destdir/

   EXAMPLE: Use multiple inputs in one command
       Copy files like foo.es.ext to foo.ext:

         ls *.es.* | perl -pe 'print; s/\.es//' | parallel -N2 cp {1} {2}

       The perl command spits out 2 lines for each input. GNU parallel takes 2 inputs (using -N2)  and  replaces
       {1} and {2} with the inputs.

       Count in binary:

         parallel -k echo ::: 0 1 ::: 0 1 ::: 0 1 ::: 0 1 ::: 0 1 ::: 0 1

       Print the number on the opposing sides of a six sided die:

         parallel --link -a <(seq 6) -a <(seq 6 -1 1) echo
         parallel --link echo :::: <(seq 6) <(seq 6 -1 1)

       Convert  files  from all subdirs to PNG-files with consecutive numbers (useful for making input PNG's for
       ffmpeg):

         parallel --link -a <(find . -type f | sort) \
           -a <(seq $(find . -type f|wc -l)) convert {1} {2}.png

       Alternative version:

         find . -type f | sort | parallel convert {} {#}.png

   EXAMPLE: Use a table as input
       Content of table_file.tsv:

         foo<TAB>bar
         baz <TAB> quux

       To run:

         cmd -o bar -i foo
         cmd -o quux -i baz

       you can run:

         parallel -a table_file.tsv --colsep '\t' cmd -o {2} -i {1}

       Note: The default for GNU parallel is to remove the spaces around the columns. To keep the spaces:

         parallel -a table_file.tsv --trim n --colsep '\t' cmd -o {2} -i {1}

   EXAMPLE: Output to database
       GNU parallel can output to a database table and a CSV-file:

         dburl=csv:///%2Ftmp%2Fmydir
         dbtableurl=$dburl/mytable.csv
         parallel --sqlandworker $dbtableurl seq ::: {1..10}

       It is rather slow and takes up a lot of CPU time because GNU parallel parses the whole CSV file for  each
       update.

       A better approach is to use an SQLite-base and then convert that to CSV:

         dburl=sqlite3:///%2Ftmp%2Fmy.sqlite
         dbtableurl=$dburl/mytable
         parallel --sqlandworker $dbtableurl seq ::: {1..10}
         sql $dburl '.headers on' '.mode csv' 'SELECT * FROM mytable;'

       This takes around a second per job.

       If you have access to a real database system, such as PostgreSQL, it is even faster:

         dburl=pg://user:pass@host/mydb
         dbtableurl=$dburl/mytable
         parallel --sqlandworker $dbtableurl seq ::: {1..10}
         sql $dburl \
           "COPY (SELECT * FROM mytable) TO stdout DELIMITER ',' CSV HEADER;"

       Or MySQL:

         dburl=mysql://user:pass@host/mydb
         dbtableurl=$dburl/mytable
         parallel --sqlandworker $dbtableurl seq ::: {1..10}
         sql -p -B $dburl "SELECT * FROM mytable;" > mytable.tsv
         perl -pe 's/"/""/g; s/\t/","/g; s/^/"/; s/$/"/;
           %s=("\\" => "\\", "t" => "\t", "n" => "\n");
           s/\\([\\tn])/$s{$1}/g;' mytable.tsv

   EXAMPLE: Output to CSV-file for R
       If  you  have  no need for the advanced job distribution control that a database provides, but you simply
       want output into a CSV file that you can read into R or LibreCalc, then you can use --results:

         parallel --results my.csv seq ::: 10 20 30
         R
         > mydf <- read.csv("my.csv");
         > print(mydf[2,])
         > write(as.character(mydf[2,c("Stdout")]),'')

   EXAMPLE: Use XML as input
       The  show  Aflyttet  on  Radio  24syv  publishes  an   RSS   feed   with   their   audio   podcasts   on:
       http://arkiv.radio24syv.dk/audiopodcast/channel/4466232

       Using xpath you can extract the URLs for 2019 and download them using GNU parallel:

         wget -O - http://arkiv.radio24syv.dk/audiopodcast/channel/4466232 | \
           xpath -e "//pubDate[contains(text(),'2019')]/../enclosure/@url" | \
           parallel -u wget '{= s/ url="//; s/"//; =}'

   EXAMPLE: Run the same command 10 times
       If you want to run the same command with the same arguments 10 times in parallel you can do:

         seq 10 | parallel -n0 my_command my_args

   EXAMPLE: Working as cat | sh. Resource inexpensive jobs and evaluation
       GNU parallel can work similar to cat | sh.

       A  resource  inexpensive  job  is  a job that takes very little CPU, disk I/O and network I/O. Ping is an
       example of a resource inexpensive job. wget is too - if the webpages are small.

       The content of the file jobs_to_run:

         ping -c 1 10.0.0.1
         wget http://example.com/status.cgi?ip=10.0.0.1
         ping -c 1 10.0.0.2
         wget http://example.com/status.cgi?ip=10.0.0.2
         ...
         ping -c 1 10.0.0.255
         wget http://example.com/status.cgi?ip=10.0.0.255

       To run 100 processes simultaneously do:

         parallel -j 100 < jobs_to_run

       As there is not a command the jobs will be evaluated by the shell.

   EXAMPLE: Call program with FASTA sequence
       FASTA files have the format:

         >Sequence name1
         sequence
         sequence continued
         >Sequence name2
         sequence
         sequence continued
         more sequence

       To call myprog with the sequence as argument run:

         cat file.fasta |
           parallel --pipe -N1 --recstart '>' --rrs \
             'read a; echo Name: "$a"; myprog $(tr -d "\n")'

   EXAMPLE: Call program with interleaved FASTQ records
       FASTQ files have the format:

         @M10991:61:000000000-A7EML:1:1101:14011:1001 1:N:0:28
         CTCCTAGGTCGGCATGATGGGGGAAGGAGAGCATGGGAAGAAATGAGAGAGTAGCAAGG
         +
         #8BCCGGGGGFEFECFGGGGGGGGG@;FFGGGEG@FF<EE<@FFC,CEGCCGGFF<FGF

       Interleaved FASTQ starts with a line like these:

         @HWUSI-EAS100R:6:73:941:1973#0/1
         @EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG
         @EAS139:136:FC706VJ:2:2104:15343:197393 1:N:18:1

       where '/1' and ' 1:' determines this is read 1.

       This will cut big.fq into one chunk per CPU core and pass it on stdin (standard  input)  to  the  program
       fastq-reader:

         parallel --pipepart -a big.fq --block -1 --regexp \
           --recend '\n' --recstart '@.*(/1| 1:.*)\n[A-Za-z\n\.~]' \
           fastq-reader

   EXAMPLE: Processing a big file using more CPUs
       To  process  a  big  file or some output you can use --pipe to split up the data into blocks and pipe the
       blocks into the processing program.

       If the program is gzip -9 you can do:

         cat bigfile | parallel --pipe --recend '' -k gzip -9 > bigfile.gz

       This will split bigfile into blocks of 1 MB and pass that to gzip -9 in parallel. One gzip  will  be  run
       per CPU. The output of gzip -9 will be kept in order and saved to bigfile.gz

       gzip  works  fine  if  the  output is appended, but some processing does not work like that - for example
       sorting. For this GNU parallel can put the output of each command into a file. This will sort a big  file
       in parallel:

         cat bigfile | parallel --pipe --files sort |\
           parallel -Xj1 sort -m {} ';' rm {} >bigfile.sort

       Here  bigfile  is  split  into  blocks of around 1MB, each block ending in '\n' (which is the default for
       --recend). Each block is passed to sort and the output from sort is saved into  files.  These  files  are
       passed  to  the second parallel that runs sort -m on the files before it removes the files. The output is
       saved to bigfile.sort.

       GNU parallel's --pipe maxes out at around 100 MB/s because every  byte  has  to  be  copied  through  GNU
       parallel.  But  if  bigfile  is  a real (seekable) file GNU parallel can by-pass the copying and send the
       parts directly to the program:

         parallel --pipepart --block 100m -a bigfile --files sort |\
           parallel -Xj1 sort -m {} ';' rm {} >bigfile.sort

   EXAMPLE: Grouping input lines
       When processing with --pipe you may have lines grouped by a value. Here is my.csv:

          Transaction Customer Item
               1       a       53
               2       b       65
               3       b       82
               4       c       96
               5       c       67
               6       c       13
               7       d       90
               8       d       43
               9       d       91
               10      d       84
               11      e       72
               12      e       102
               13      e       63
               14      e       56
               15      e       74

       Let us assume you want GNU parallel  to  process  each  customer.  In  other  words:  You  want  all  the
       transactions for a single customer to be treated as a single record.

       To  do  this  we  preprocess the data with a program that inserts a record separator before each customer
       (column 2 = $F[1]). Here we first make a 50 character random string, which we then use as the separator:

         sep=`perl -e 'print map { ("a".."z","A".."Z")[rand(52)] } (1..50);'`
         cat my.csv | \
            perl -ape '$F[1] ne $l and print "'$sep'"; $l = $F[1]' | \
            parallel --recend $sep --rrs --pipe -N1 wc

       If your program can process multiple customers replace -N1 with a reasonable --blocksize.

   EXAMPLE: Running more than 250 jobs workaround
       If you need to run a massive amount of jobs in parallel, then you will likely hit  the  filehandle  limit
       which   is   often   around   250   jobs.   If   you   are   super  user  you  can  raise  the  limit  in
       /etc/security/limits.conf but you can also use this workaround. The filehandle limit is per process. That
       means that if you just spawn more GNU parallels then each of them can run 250 jobs. This will spawn up to
       2500 jobs:

         cat myinput |\
           parallel --pipe -N 50 --roundrobin -j50 parallel -j50 your_prg

       This will spawn up to 62500 jobs (use with caution - you need 64 GB RAM to do this, and you may  need  to
       increase /proc/sys/kernel/pid_max):

         cat myinput |\
           parallel --pipe -N 250 --roundrobin -j250 parallel -j250 your_prg

   EXAMPLE: Working as mutex and counting semaphore
       The command sem is an alias for parallel --semaphore.

       A  counting semaphore will allow a given number of jobs to be started in the background.  When the number
       of jobs are running in the background, GNU sem will wait for one of these  to  complete  before  starting
       another command. sem --wait will wait for all jobs to complete.

       Run 10 jobs concurrently in the background:

         for i in *.log ; do
           echo $i
           sem -j10 gzip $i ";" echo done
         done
         sem --wait

       A mutex is a counting semaphore allowing only one job to run. This will edit the file myfile and prepends
       the file with lines with the numbers 1 to 3.

         seq 3 | parallel sem sed -i -e '1i{}' myfile

       As myfile can be very big it is important only one process edits the file at the same time.

       Name the semaphore to have multiple different semaphores active at the same time:

         seq 3 | parallel sem --id mymutex sed -i -e '1i{}' myfile

   EXAMPLE: Mutex for a script
       Assume  a  script  is called from cron or from a web service, but only one instance can be run at a time.
       With sem and --shebang-wrap the script can be made to wait for other instances to finish. Here in bash:

         #!/usr/bin/sem --shebang-wrap -u --id $0 --fg /bin/bash

         echo This will run
         sleep 5
         echo exclusively

       Here perl:

         #!/usr/bin/sem --shebang-wrap -u --id $0 --fg /usr/bin/perl

         print "This will run ";
         sleep 5;
         print "exclusively\n";

       Here python:

         #!/usr/local/bin/sem --shebang-wrap -u --id $0 --fg /usr/bin/python

         import time
         print "This will run ";
         time.sleep(5)
         print "exclusively";

   EXAMPLE: Start editor with filenames from stdin (standard input)
       You can use GNU parallel to start interactive programs like emacs or vi:

         cat filelist | parallel --tty -X emacs
         cat filelist | parallel --tty -X vi

       If there are more files than will fit on a single command line, the editor will be started again with the
       remaining files.

   EXAMPLE: Running sudo
       sudo requires a password to run a command as root. It caches the access, so you only need  to  enter  the
       password again if you have not used sudo for a while.

       The command:

         parallel sudo echo ::: This is a bad idea

       is no good, as you would be prompted for the sudo password for each of the jobs. You can either do:

         sudo echo This
         parallel sudo echo ::: is a good idea

       or:

         sudo parallel echo ::: This is a good idea

       This way you only have to enter the sudo password once.

   EXAMPLE: GNU Parallel as queue system/batch manager
       GNU  parallel can work as a simple job queue system or batch manager.  The idea is to put the jobs into a
       file and have GNU parallel read from that continuously. As GNU parallel will stop at end of file  we  use
       tail to continue reading:

         true >jobqueue; tail -n+0 -f jobqueue | parallel

       To submit your jobs to the queue:

         echo my_command my_arg >> jobqueue

       You can of course use -S to distribute the jobs to remote computers:

         true >jobqueue; tail -n+0 -f jobqueue | parallel -S ..

       If  you  keep this running for a long time, jobqueue will grow. A way of removing the jobs already run is
       by making GNU parallel stop when it hits a special value and then restart.  To  use  --eof  to  make  GNU
       parallel exit, tail also needs to be forced to exit:

         true >jobqueue;
         while true; do
           tail -n+0 -f jobqueue |
             (parallel -E StOpHeRe -S ..; echo GNU Parallel is now done;
              perl -e 'while(<>){/StOpHeRe/ and last};print <>' jobqueue > j2;
              (seq 1000 >> jobqueue &);
              echo Done appending dummy data forcing tail to exit)
           echo tail exited;
           mv j2 jobqueue
         done

       In some cases you can run on more CPUs and computers during the night:

         # Day time
         echo 50% > jobfile
         cp day_server_list ~/.parallel/sshloginfile
         # Night time
         echo 100% > jobfile
         cp night_server_list ~/.parallel/sshloginfile
         tail -n+0 -f jobqueue | parallel --jobs jobfile -S ..

       GNU parallel discovers if jobfile or ~/.parallel/sshloginfile changes.

       There  is  a  a  small  issue  when  using GNU parallel as queue system/batch manager: You have to submit
       JobSlot number of jobs before they will start, and after that you can submit one at a time, and job  will
       start immediately if free slots are available.

       Output  from  the  running  or completed jobs are held back and will only be printed when the next job is
       started (unless you use --ungroup or --line-buffer, in which case the output from the  jobs  are  printed
       immediately).

       E.g.  if  you have 10 jobslots then the output from the first completed job will only be printed when job
       11 has started, and the output of second completed job will only be printed when job 12 has started.

   EXAMPLE: GNU Parallel as dir processor
       If you have a dir in which users drop files that needs to be processed you can do this on  GNU/Linux  (If
       you know what inotifywait is called on other platforms file a bug report):

         inotifywait -qmre MOVED_TO -e CLOSE_WRITE --format %w%f my_dir |\
           parallel -u echo

       This will run the command echo on each file put into my_dir or subdirs of my_dir.

       You can of course use -S to distribute the jobs to remote computers:

         inotifywait -qmre MOVED_TO -e CLOSE_WRITE --format %w%f my_dir |\
           parallel -S ..  -u echo

       If  the files to be processed are in a tar file then unpacking one file and processing it immediately may
       be faster than first unpacking all files. Set up the dir processor as above and unpack into the dir.

       Using GNU parallel as dir processor has the same limitations as using GNU parallel as queue  system/batch
       manager.

   EXAMPLE: Locate the missing package
       If you have downloaded source and tried compiling it, you may have seen:

         $ ./configure
         [...]
         checking for something.h... no
         configure: error: "libsomething not found"

       Often  it  is  not  obvious  which  package you should install to get that file. Debian has `apt-file` to
       search for a file. `tracefile`  from  https://gitlab.com/ole.tange/tangetools  can  tell  which  files  a
       program tried to access. In this case we are interested in one of the last files:

         $ tracefile -un ./configure | tail | parallel -j0 apt-file search

SPREADING BLOCKS OF DATA

       --round-robin, --pipe-part, --shard, --bin and --group-by are all specialized versions of --pipe.

       In  the  following  n is the number of jobslots given by --jobs. A record starts with --recstart and ends
       with --recend. It is typically a full line. A chunk is a number of full records that is approximately the
       size of a block. A block can contain half records, a chunk cannot.

       --pipe starts one job per chunk. It reads blocks from stdin (standard input). It finds a record end  near
       a block border and passes a chunk to the program.

       --pipe-part  starts  one  job per chunk - just like normal --pipe. It first finds record endings near all
       block borders in the file and then starts the jobs. By using --block -1 it will set the block size to 1/n
       * size-of-file. Used this way it will start n jobs in total.

       --round-robin starts n jobs in total. It reads a block and passes a chunk to whichever job  is  ready  to
       read.  It  does  not  parse  the  content except for identifying where a record ends to make sure it only
       passes full records.

       --shard starts n jobs in total. It parses each line to read the value in the given column. Based on  this
       value  the  line  is  passed  to one of the n jobs. All lines having this value will be given to the same
       jobslot.

       --bin works like --shard but the value of the column is the jobslot number it will be passed to.  If  the
       value  is  bigger  than  n,  then n will be subtracted from the value until the values is smaller than or
       equal to n.

       --group-by starts one job per chunk. Record borders are  not  given  by  --recend/--recstart.  Instead  a
       record  is  defined by a number of lines having the same value in a given column. So the value of a given
       column changes at a chunk border. With --pipe every line is parsed, with --pipe-part only a few lines are
       parsed to find the chunk border.

       --group-by can be combined with --round-robin or --pipe-part.

UNIT PREFIX

       Many numerical arguments in GNU parallel can be postfixed with K, M, G, T, P, k, m,  g,  t,  or  p  which
       would multiply the number with 1024, 1048576, 1073741824, 1099511627776, 1125899906842624, 1000, 1000000,
       1000000000, 1000000000000, or 1000000000000000, respectively.

       You can even give it as a math expression. E.g. 1000000 can be written as 1M-12*2.024*2k.

QUOTING

       GNU  parallel  is very liberal in quoting. You only need to quote characters that have special meaning in
       shell:

         ( ) $ ` ' " < > ; | \

       and depending on context these needs to be quoted, too:

         ~ & # ! ? space * {

       Therefore most people will never need more quoting than putting '\' in front of the special characters.

       Often you can simply put \' around every ':

         perl -ne '/^\S+\s+\S+$/ and print $ARGV,"\n"' file

       can be quoted:

         parallel perl -ne \''/^\S+\s+\S+$/ and print $ARGV,"\n"'\' ::: file

       However, when you want to use a shell variable you need to quote the $-sign. Here  is  an  example  using
       $PARALLEL_SEQ.  This  variable  is set by GNU parallel itself, so the evaluation of the $ must be done by
       the sub shell started by GNU parallel:

         seq 10 | parallel -N2 echo seq:\$PARALLEL_SEQ arg1:{1} arg2:{2}

       If the variable is set before GNU parallel starts you can do this:

         VAR=this_is_set_before_starting
         echo test | parallel echo {} $VAR

       Prints: test this_is_set_before_starting

       It is a little more tricky if the variable contains more than one space in a row:

         VAR="two  spaces  between  each  word"
         echo test | parallel echo {} \'"$VAR"\'

       Prints: test two  spaces  between  each  word

       If the variable should not be evaluated by the shell starting GNU parallel but be evaluated  by  the  sub
       shell started by GNU parallel, then you need to quote it:

         echo test | parallel VAR=this_is_set_after_starting \; echo {} \$VAR

       Prints: test this_is_set_after_starting

       It is a little more tricky if the variable contains space:

         echo test |\
           parallel VAR='"two  spaces  between  each  word"' echo {} \'"$VAR"\'

       Prints: test two  spaces  between  each  word

       $$  is  the  shell variable containing the process id of the shell. This will print the process id of the
       shell running GNU parallel:

         seq 10 | parallel echo $$

       And this will print the process ids of the sub shells started by GNU parallel.

         seq 10 | parallel echo \$\$

       If the special characters should not be evaluated by the sub shell then you need to  protect  it  against
       evaluation from both the shell starting GNU parallel and the sub shell:

         echo test | parallel echo {} \\\$VAR

       Prints: test $VAR

       GNU parallel can protect against evaluation by the sub shell by using -q:

         echo test | parallel -q echo {} \$VAR

       Prints: test $VAR

       This is particularly useful if you have lots of quoting. If you want to run a perl script like this:

         perl -ne '/^\S+\s+\S+$/ and print $ARGV,"\n"' file

       It needs to be quoted like one of these:

         ls | parallel perl -ne '/^\\S+\\s+\\S+\$/\ and\ print\ \$ARGV,\"\\n\"'
         ls | parallel perl -ne \''/^\S+\s+\S+$/ and print $ARGV,"\n"'\'

       Notice  how  spaces, \'s, "'s, and $'s need to be quoted. GNU parallel can do the quoting by using option
       -q:

         ls | parallel -q  perl -ne '/^\S+\s+\S+$/ and print $ARGV,"\n"'

       However, this means you cannot make the sub shell interpret special characters. For example because of -q
       this WILL NOT WORK:

         ls *.gz | parallel -q "zcat {} >{.}"
         ls *.gz | parallel -q "zcat {} | bzip2 >{.}.bz2"

       because > and | need to be interpreted by the sub shell.

       If you get errors like:

         sh: -c: line 0: syntax error near unexpected token
         sh: Syntax error: Unterminated quoted string
         sh: -c: line 0: unexpected EOF while looking for matching `''
         sh: -c: line 1: syntax error: unexpected end of file
         zsh:1: no matches found:

       then you might try using -q.

       If you are using bash process substitution like <(cat foo) then you may try  -q  and  prepending  command
       with bash -c:

         ls | parallel -q bash -c 'wc -c <(echo {})'

       Or for substituting output:

         ls | parallel -q bash -c \
           'tar c {} | tee >(gzip >{}.tar.gz) | bzip2 >{}.tar.bz2'

       Conclusion: To avoid dealing with the quoting problems it may be easier just to write a small script or a
       function (remember to export -f the function) and have GNU parallel call that.

LIST RUNNING JOBS

       If you want a list of the jobs currently running you can run:

         killall -USR1 parallel

       GNU parallel will then print the currently running jobs on stderr (standard error).

COMPLETE RUNNING JOBS BUT DO NOT START NEW JOBS

       If  you regret starting a lot of jobs you can simply break GNU parallel, but if you want to make sure you
       do not have half-completed jobs you should send the signal SIGHUP to GNU parallel:

         killall -HUP parallel

       This will tell GNU parallel to not start any new jobs, but wait until  the  currently  running  jobs  are
       finished before exiting.

ENVIRONMENT VARIABLES

       $PARALLEL_HOME
                Dir  where  GNU  parallel  stores  config  files,  semaphores,  and  caches  information between
                invocations. Default: $HOME/.parallel.

       $PARALLEL_ARGHOSTGROUPS
                When using --hostgroups GNU parallel sets this to the hostgroups of the job.

                Remember to quote the $, so it gets evaluated by the correct shell. Or use --plus and {agrp}.

       $PARALLEL_HOSTGROUPS
                When using --hostgroups GNU parallel sets this to the hostgroups of the sshlogin that the job is
                run on.

                Remember to quote the $, so it gets evaluated by the correct shell. Or use --plus and {hgrp}.

       $PARALLEL_JOBSLOT
                Set by GNU parallel and can be used in jobs run by GNU parallel.  Remember to quote the $, so it
                gets evaluated by the correct shell. Or use --plus and {slot}.

                $PARALLEL_JOBSLOT is the jobslot of the job. It is equal to {%} unless the job is being retried.
                See {%} for details.

       $PARALLEL_PID
                Set by GNU parallel and can be used in jobs run by GNU parallel.  Remember to quote the $, so it
                gets evaluated by the correct shell.

                This makes it possible for the jobs to communicate directly to GNU parallel.

                Example: If each of the jobs tests a solution and one of jobs finds the  solution  the  job  can
                tell  GNU  parallel  not  to start more jobs by: kill -HUP $PARALLEL_PID. This only works on the
                local computer.

       $PARALLEL_RSYNC_OPTS
                Options to pass on to rsync. Defaults to: -rlDzR.

       $PARALLEL_SHELL
                Use this shell for the commands run by GNU parallel:

                • $PARALLEL_SHELL. If undefined use:

                • The shell that started GNU parallel. If that cannot be determined:

                • $SHELL. If undefined use:

                • /bin/sh

       $PARALLEL_SSH
                GNU parallel defaults to using the ssh command for remote access. This can  be  overridden  with
                $PARALLEL_SSH,  which  again  can  be  overridden with --ssh. It can also be set on a per server
                basis (see --sshlogin).

       $PARALLEL_SSHHOST
                Set by GNU parallel and can be used in jobs run by GNU parallel.  Remember to quote the $, so it
                gets evaluated by the correct shell. Or use --plus and {host}.

                $PARALLEL_SSHHOST is the host part of an sshlogin line. E.g.

                  4//usr/bin/specialssh user@host

                becomes:

                  host

       $PARALLEL_SSHLOGIN
                Set by GNU parallel and can be used in jobs run by GNU parallel.  Remember to quote the $, so it
                gets evaluated by the correct shell. Or use --plus and {sshlogin}.

                The value is the sshlogin line with number of cores removed. E.g.

                  4//usr/bin/specialssh user@host

                becomes:

                  /usr/bin/specialssh user@host

       $PARALLEL_SEQ
                Set by GNU parallel and can be used in jobs run by GNU parallel.  Remember to quote the $, so it
                gets evaluated by the correct shell.

                $PARALLEL_SEQ is the sequence number of the job running.

                Example:

                  seq 10 | parallel -N2 \
                    echo seq:'$'PARALLEL_SEQ arg1:{1} arg2:{2}

                {#} is a shorthand for $PARALLEL_SEQ.

       $PARALLEL_TMUX
                Path to tmux. If unset the tmux in $PATH is used.

       $TMPDIR  Directory for temporary files. See: --tmpdir.

       $PARALLEL
                The environment variable $PARALLEL will be used as default options  for  GNU  parallel.  If  the
                variable  contains  special  shell  characters (e.g. $, *, or space) then these need to be to be
                escaped with \.

                Example:

                  cat list | parallel -j1 -k -v ls
                  cat list | parallel -j1 -k -v -S"myssh user@server" ls

                can be written as:

                  cat list | PARALLEL="-kvj1" parallel ls
                  cat list | PARALLEL='-kvj1 -S myssh\ user@server' \
                    parallel echo

                Notice the \ after 'myssh' is needed because 'myssh' and 'user@server' must be one argument.

DEFAULT PROFILE (CONFIG FILE)

       The   global   configuration   file   /etc/parallel/config,   followed   by   user   configuration   file
       ~/.parallel/config  (formerly  known  as .parallelrc) will be read in turn if they exist.  Lines starting
       with '#' will be ignored. The format can follow that of the environment variable  $PARALLEL,  but  it  is
       often easier to simply put each option on its own line.

       Options  on  the  command  line  take  precedence,  followed  by the environment variable $PARALLEL, user
       configuration file ~/.parallel/config, and finally the global configuration file /etc/parallel/config.

       Note that no file that is read for options, nor the environment variable $PARALLEL, may  contain  retired
       options such as --tollef.

PROFILE FILES

       If  --profile  set,  GNU  parallel  will  read  the profile from that file rather than the global or user
       configuration files. You can have multiple --profiles.

       Profiles are searched for in ~/.parallel. If the name starts with / it is seen as an  absolute  path.  If
       the name starts with ./ it is seen as a relative path from current dir.

       Example:  Profile for running a command on every sshlogin in ~/.ssh/sshlogins and prepend the output with
       the sshlogin:

         echo --tag -S .. --nonall > ~/.parallel/nonall_profile
         parallel -J nonall_profile uptime

       Example: Profile for running every command with -j-1 and nice

         echo -j-1 nice > ~/.parallel/nice_profile
         parallel -J nice_profile bzip2 -9 ::: *

       Example: Profile for running a perl script before every command:

         echo "perl -e '\$a=\$\$; print \$a,\" \",'\$PARALLEL_SEQ',\" \";';" \
           > ~/.parallel/pre_perl
         parallel -J pre_perl echo ::: *

       Note how the $ and " need to be quoted using \.

       Example: Profile for running distributed jobs with nice on the remote computers:

         echo -S .. nice > ~/.parallel/dist
         parallel -J dist --trc {.}.bz2 bzip2 -9 ::: *

EXIT STATUS

       Exit status depends on --halt-on-error if one of these is used: success=X, success=Y%, fail=Y%.

       0     All jobs ran without error. If success=X is used: X jobs ran without error. If success=Y% is  used:
             Y% of the jobs ran without error.

       1-100 Some  of  the  jobs failed. The exit status gives the number of failed jobs. If Y% is used the exit
             status is the percentage of jobs that failed.

       101   More than 100 jobs failed.

       255   Other error.

       -1 (In joblog and SQL table)
             Killed by Ctrl-C, timeout, not enough memory or similar.

       -2 (In joblog and SQL table)
             skip() was called in {= =}.

       -1000 (In SQL table)
             Job is ready to run (set by --sqlmaster).

       -1220 (In SQL table)
             Job is taken by worker (set by --sqlworker).

       If fail=1 is used, the exit status will be the exit status of the failing job.

DIFFERENCES BETWEEN GNU Parallel AND ALTERNATIVES

       See: man parallel_alternatives

BUGS

   Quoting of newline
       Because of the way newline is quoted this will not work:

         echo 1,2,3 | parallel -vkd, "echo 'a{}b'"

       However, these will all work:

         echo 1,2,3 | parallel -vkd, echo a{}b
         echo 1,2,3 | parallel -vkd, "echo 'a'{}'b'"
         echo 1,2,3 | parallel -vkd, "echo 'a'"{}"'b'"

   Speed
       Startup

       GNU parallel is slow at starting up - around 250 ms the first time and 150 ms after that.

       Job startup

       Starting a job on the local machine takes around 10 ms. This can be a big overhead if the job takes  very
       few  ms  to  run.  Often  you  can  group  small jobs together using -X which will make the overhead less
       significant. Or you can run multiple GNU parallels as described in EXAMPLE: Speeding up fast jobs.

       SSH

       When using multiple computers GNU parallel  opens  ssh  connections  to  them  to  figure  out  how  many
       connections  can  be used reliably simultaneously (Namely SSHD's MaxStartups). This test is done for each
       host in serial, so if your --sshloginfile contains many hosts it may be slow.

       If your jobs are short you may see that there are fewer jobs running on the remote systems than expected.
       This is due to time spent logging in and out. -M may help here.

       Disk access

       A single disk can normally read data faster if it reads one file at a time instead of reading  a  lot  of
       files  in  parallel,  as this will avoid disk seeks. However, newer disk systems with multiple drives can
       read faster if reading from multiple files in parallel.

       If the jobs are of the form read-all-compute-all-write-all, so everything  is  read  before  anything  is
       written, it may be faster to force only one disk access at the time:

         sem --id diskio cat file | compute | sem --id diskio cat > file

       If  the  jobs are of the form read-compute-write, so writing starts before all reading is done, it may be
       faster to force only one reader and writer at the time:

         sem --id read cat file | compute | sem --id write cat > file

       If the jobs are of the form read-compute-read-compute, it may be faster to run more jobs in parallel than
       the system has CPUs, as some of the jobs will be stuck waiting for disk access.

   --nice limits command length
       The current implementation of --nice is too pessimistic in the max allowed command length. It only uses a
       little more than half of what it could. This affects -X and -m. If this becomes a real problem  for  you,
       file a bug-report.

   Aliases and functions do not work
       If you get:

         Can't exec "command": No such file or directory

       or:

         open3: exec of by command failed

       or:

         /bin/bash: command: command not found

       it  may  be because command is not known, but it could also be because command is an alias or a function.
       If it is a function you need to export -f the function first or use env_parallel. An alias will only work
       if you use env_parallel.

   Database with MySQL fails randomly
       The --sql* options may fail randomly with MySQL. This problem does not exist with PostgreSQL.

REPORTING BUGS

       Report bugs to <bug-parallel@gnu.org> or https://savannah.gnu.org/bugs/?func=additem&group=parallel

       When you write your report, please keep in mind, that you must give the reader enough information  to  be
       able  to  run exactly what you run. So you need to include all data and programs that you use to show the
       problem.

       See a perfect bug report on https://lists.gnu.org/archive/html/bug-parallel/2015-01/msg00000.html

       Your bug report should always include:

       • The error message you get (if any). If the error message is not from GNU parallel you need to show  why
         you think GNU parallel caused this.

       • The  complete  output  of  parallel  --version. If you are not running the latest released version (see
         https://ftp.gnu.org/gnu/parallel/) you should specify why you believe the problem is not fixed in  that
         version.

       • A minimal, complete, and verifiable example (See description on https://stackoverflow.com/help/mcve).

         It  should be a complete example that others can run which shows the problem including all files needed
         to run the example. This should preferably be small and simple, so try to remove  as  many  options  as
         possible.

         A combination of yes, seq, cat, echo, wc, and sleep can reproduce most errors.

         If  your  example  requires  large  files, see if you can make them with something like seq 100000000 >
         bigfile or yes | head -n 1000000000 > file. If you need multiple columns: paste <(seq 1000) <(seq  1000
         1999)

         If your example requires remote execution, see if you can use localhost - maybe using another login.

         If  you  have  access to a different system (maybe a VirtualBox on your own machine), test if your MCVE
         shows the problem on that system. If it does not, read below.

       • The output of your example. If your problem is not easily reproduced by others, the output  might  help
         them figure out the problem.

       • Whether  you  have watched the intro videos (https://www.youtube.com/playlist?list=PL284C9FF2488BC6D1),
         walked through the tutorial (man parallel_tutorial), and read the EXAMPLE section in the man page  (man
         parallel - search for EXAMPLE:).

   Bug dependent on environment
       If  you  suspect  the  error  is  dependent  on  your  environment or distribution, please see if you can
       reproduce       the       error       on       one       of        these        VirtualBox        images:
       https://sourceforge.net/projects/virtualboximage/files/ https://www.osboxes.org/virtualbox-images/

       Specifying  the name of your distribution is not enough as you may have installed software that is not in
       the VirtualBox images.

       If you cannot reproduce the error on any of  the  VirtualBox  images  above,  see  if  you  can  build  a
       VirtualBox  image  on  which  you can reproduce the error. If not you should assume the debugging will be
       done through you. That will put more burden on you and it is extra important  you  give  any  information
       that  help.  In  general the problem will be fixed faster and with less work for you if you can reproduce
       the error on a VirtualBox.

   In summary
       Your report must include:

       • parallel --version

       • output + error message

       • full example including all files

       • VirtualBox image, if you cannot reproduce it on other systems

AUTHOR

       When using GNU parallel for a publication please cite:

       O. Tange (2011): GNU Parallel - The Command-Line  Power  Tool,  ;login:  The  USENIX  Magazine,  February
       2011:42-47.

       Copyright (C) 2007-10-18 Ole Tange, http://ole.tange.dk

       Copyright (C) 2008-2010 Ole Tange, http://ole.tange.dk

       Copyright (C) 2010-2021 Ole Tange, http://ole.tange.dk and Free Software Foundation, Inc.

       Parts  of the manual concerning xargs compatibility is inspired by the manual of xargs from GNU findutils
       4.4.2.

LICENSE

       This program is free software; you can redistribute it and/or modify  it  under  the  terms  of  the  GNU
       General  Public License as published by the Free Software Foundation; either version 3 of the License, or
       at your option any later version.

       This program is distributed in the hope that it will be useful, but WITHOUT ANY  WARRANTY;  without  even
       the  implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General Public
       License for more details.

       You should have received a copy of the GNU General Public License along with this program.  If  not,  see
       <https://www.gnu.org/licenses/>.

   Documentation license I
       Permission  is  granted  to  copy, distribute and/or modify this documentation under the terms of the GNU
       Free Documentation License, Version 1.3 or any later version published by the Free  Software  Foundation;
       with  no  Invariant  Sections,  with  no  Front-Cover Texts, and with no Back-Cover Texts.  A copy of the
       license is included in the file LICENSES/GFDL-1.3-or-later.txt.

   Documentation license II
       You are free:

       to Share to copy, distribute and transmit the work

       to Remix to adapt the work

       Under the following conditions:

       Attribution
                You must attribute the work in the manner specified by the author or licensor (but  not  in  any
                way that suggests that they endorse you or your use of the work).

       Share Alike
                If  you  alter,  transform,  or build upon this work, you may distribute the resulting work only
                under the same, similar or a compatible license.

       With the understanding that:

       Waiver   Any of the above conditions can be waived if you get permission from the copyright holder.

       Public Domain
                Where the work or any of its elements is in the public domain under applicable law, that  status
                is in no way affected by the license.

       Other Rights
                In no way are any of the following rights affected by the license:

                • Your  fair  dealing  or  fair  use  rights,  or  other  applicable  copyright  exceptions  and
                  limitations;

                • The author's moral rights;

                • Rights other persons may have either in the work itself or in how the work is  used,  such  as
                  publicity or privacy rights.

       Notice   For any reuse or distribution, you must make clear to others the license terms of this work.

       A copy of the full license is included in the file as LICENCES/CC-BY-SA-4.0.txt

DEPENDENCIES

       GNU  parallel  uses  Perl,  and  the  Perl modules Getopt::Long, IPC::Open3, Symbol, IO::File, POSIX, and
       File::Temp.

       For --csv it uses the Perl module Text::CSV.

       For remote usage it uses rsync with ssh.

SEE ALSO

       parallel_tutorial(1),     env_parallel(1),     parset(1),      parsort(1),      parallel_alternatives(1),
       parallel_design(7), niceload(1), sql(1), ssh(1), ssh-agent(1), sshpass(1), ssh-copy-id(1), rsync(1)

20210822                                           2021-08-28                                        PARALLEL(1)